Agency Information Collection Activities: Proposed Collection: Public Comment Request; Information Collection Request Title: The National Health Service Corps and Nurse Corps Interest Capture Form OMB No. 0915-0337-Extension, 325-326 [2019-28368]

Download as PDF 325 Federal Register / Vol. 85, No. 2 / Friday, January 3, 2020 / Notices Number of respondents Form name Heart/Lung Follow Up (6 Month) ......................................... Heart/Lung Follow Up (1–5 Year) ........................................ Heart/Lung Follow Up (Post 5 Year) ................................... Heart/Lung Post-Transplant Malignancy Form .................... Liver Candidate Registration ............................................... Liver Recipient Registration ................................................. Liver Follow-up (6 Month–5 Year) ....................................... Liver Follow-up (Post 5 Year) .............................................. Liver Recipient Explant Pathology Form ............................. Liver Post-Transplant Malignancy ....................................... Intestine Candidate Registration .......................................... Intestine Recipient Registration ........................................... Intestine Follow Up (6 Month–5 Year) ................................. Intestine Follow Up (Post 5 Year) ....................................... Intestine Post-Transplant Malignancy Form ........................ Kidney Candidate Registration ............................................ Kidney Recipient Registration .............................................. Kidney Follow-Up (6 Month–5 Year) ................................... Kidney Follow-up (Post 5 Year) ........................................... Kidney Post-Transplant Malignancy Form ........................... Pancreas Candidate Registration ........................................ Pancreas Recipient Registration ......................................... Pancreas Follow-up (6 Month–5 Year) ................................ Pancreas Follow-up (Post 5 Year) ...................................... Pancreas Post-Transplant Malignancy Form ...................... Kidney/Pancreas Candidate Registration ............................ Kidney/Pancreas Recipient Registration ............................. Kidney/Pancreas Follow-up (6 Month–5 Year) .................... Kidney/Pancreas Follow-up (Post 5 Year) .......................... Kidney/Pancreas Post-Transplant Malignancy Form .......... VCA Candidate Registration ................................................ VCA Recipient Registration ................................................. VCA Recipient Follow Up .................................................... 69 69 69 69 146 146 146 146 146 146 20 20 20 20 20 237 237 237 237 237 133 133 133 133 133 133 133 133 133 133 27 27 27 Total .............................................................................. 6,204 Number of responses per respondent * 0.4 1.1 3.3 0.3 90.3 56.5 266.6 316.6 10.6 16.3 7.0 5.2 26.2 37.2 2.1 168.8 89.4 431.9 449.4 22.6 2.8 1.5 7.9 15.9 0.7 9.8 7.7 32.8 57.8 2.2 0.9 1.6 0.7 Total responses 31 79 228 21 13,183 8,256 38,919 46,225 1,544 2,387 139 104 524 744 42 39,998 21,195 102,350 106,507 5,365 368 194 1,047 2,119 97 1,297 1,028 4,363 7,688 292 24 43 18 567,472 Average burden per response (in hours) 0.8 1.1 0.6 0.4 0.8 1.2 1.0 0.5 0.6 0.8 1.3 1.8 1.5 0.4 1.0 0.8 1.2 0.9 0.5 0.8 0.6 1.2 0.5 0.5 0.6 0.6 1.2 0.5 0.6 0.4 0.4 1.3 1.0 Total burden hours 24.8 86.9 136.8 8.4 10,546.4 9,907.2 38,919.0 23,112.5 926.4 1,909.6 180.7 187.2 786.0 297.6 42.0 31,998.4 25,434.0 92,115.0 53,253.5 4,292.0 220.8 232.8 523.5 1,059.5 58.2 778.2 1,233.6 2,181.5 4,612.8 116.8 9.6 55.9 18.0 425,925.1 * The Number of Responses per Respondent was calculated by dividing the Total Responses by the Number of Respondents and rounding to the nearest tenth. HRSA specifically requests comments on (1) the necessity and utility of the proposed information collection for the proper performance of the agency’s functions; (2) the accuracy of the estimated burden; (3) ways to enhance the quality, utility, and clarity of the information to be collected; and (4) the use of automated collection techniques or other forms of information technology to minimize the information collection burden. DEPARTMENT OF HEALTH AND HUMAN SERVICES Maria G. Button, Director, Executive Secretariat. AGENCY: [FR Doc. 2019–28370 Filed 1–2–20; 8:45 am] BILLING CODE 4165–15–P Health Resources and Services Administration Agency Information Collection Activities: Proposed Collection: Public Comment Request; Information Collection Request Title: The National Health Service Corps and Nurse Corps Interest Capture Form OMB No. 0915– 0337—Extension Health Resources and Services Administration (HRSA), Department of Health and Human Services. ACTION: Notice. In compliance with the requirement for opportunity for public comment on proposed data collection projects of the Paperwork Reduction Act of 1995, HRSA announces plans to submit an Information Collection Request (ICR), described below, to the Office of Management and Budget (OMB). Prior to submitting the ICR to OMB, HRSA seeks comments from the jbell on DSKJLSW7X2PROD with NOTICES SUMMARY: VerDate Sep<11>2014 17:29 Jan 02, 2020 Jkt 250001 PO 00000 Frm 00029 Fmt 4703 Sfmt 4703 public regarding the burden estimate, below, or any other aspect of the ICR. DATES: Comments on this ICR should be received no later than March 3, 2020. ADDRESSES: Submit your comments to paperwork@hrsa.gov or mail the HRSA Information Collection Clearance Officer, Room 14N136B, 5600 Fishers Lane, Rockville, MD 20857. FOR FURTHER INFORMATION CONTACT: To request more information on the proposed project or to obtain a copy of the data collection plans and draft instruments, email paperwork@hrsa.gov or call Lisa Wright-Solomon, the HRSA Information Collection Clearance Officer at (301) 443–1984. SUPPLEMENTARY INFORMATION: When submitting comments or requesting information, please include the information request collection title for reference. Information Collection Request Title: The National Health Service Corps and Nurse Corps Interest Capture Form OMB No. 0915–0337—Extension Abstract: The National Health Service Corps (NHSC) and the Nurse Corps of E:\FR\FM\03JAN1.SGM 03JAN1 326 Federal Register / Vol. 85, No. 2 / Friday, January 3, 2020 / Notices the Bureau of Health Workforce (BHW), HRSA, are both committed to improving the health of the Nation’s underserved by uniting communities in need with caring health professionals and by supporting communities’ efforts to build better systems of care. The NHSC and Nurse Corps Interest Capture Form, which is used when HRSA staff presents information regarding HRSA funding opportunities for health profession students and providers at national and regional conferences and at campus recruiting events, is an optional form that a health profession student, licensed clinician, faculty member, or clinical site administrator can complete and submit to BHW representatives at an event. The purpose of the form is to enable individuals and clinical sites to ask BHW for periodic program updates and other general information regarding opportunities with the NHSC and/or the Nurse Corps via email. Completed forms contain information such as the names of the individuals, their email address(es), their city and state, the organization where they are employed (or the school which they attend), the year they intend to graduate (if applicable), how they heard about the NHSC/Nurse Corps, and the programs in which they are interested. Assistance in completing the form will be given by the BHW staff person (or BHW representative) who is present at the event. Need and Proposed Use of the Information: The need and purpose of this information collection is to share resources and information regarding the NHSC and Nurse Corps programs with interested conference/event participants. Likely Respondents: Individual and potential service site conference/event Number of respondents Form name Number of responses per respondent Total responses Average burden per response (in hours) Total burden hours NHSC and Nurse Corps Interest Capture Form ................. 2,400 1 2,400 .025 60 Total .............................................................................. 2,400 ........................ 2,400 ........................ 60 HRSA specifically requests comments on (1) the necessity and utility of the proposed information collection for the proper performance of the agency’s functions, (2) the accuracy of the estimated burden, and (3) ways to enhance the quality, utility, and clarity of the information to be collected. Maria G. Button, Director, Executive Secretariat. [FR Doc. 2019–28368 Filed 1–2–20; 8:45 am] BILLING CODE 4165–15–P practice the inventions embodied in the Patents and Patent Applications listed in the Supplementary Information section of this notice to Morphiex Biotherapeutics (‘‘Morphiex’’) located in Boston, MA. DATES: Only written comments and/or applications for a license which are received by the National Cancer Institute’s Technology Transfer Center on or before January 21, 2020 will be considered. Requests for copies of the patent application, inquiries, and comments relating to the contemplated an Exclusive Patent License should be directed to: Jaime Greene, Senior Licensing and Patenting Manager, NCI Technology Transfer Center, 9609 Medical Center Drive, RM 1E530, MSC 9702, Bethesda, MD 20892–9702 (for business mail), Rockville, MD 20850– 9702, Telephone: (240) 276–5530; Facsimile: (240) 276–5504; Email: greenejaime@mail.nih.gov. SUPPLEMENTARY INFORMATION: This is in reference to previous notices 83 FR 22501, which was a Prospective Grant of an Exclusive Patent License to Morphiex for the field of use ‘‘the use of the CD47 phosphorodiamidate morpholino oligomers (PMO, morpholino, Sequence: 5′CGTCACAGGCAGGACCCACTGCCCAADDRESSES: DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health Prospective Grant of an Exclusive Patent License: Use of the CD47 Phosphorodiamidate Morpholino Oligomers for the Treatment, Prevention, and Diagnosis of Solid Tumors AGENCY: National Institutes of Health, HHS. jbell on DSKJLSW7X2PROD with NOTICES participants interested in the NHSC or Nurse Corps programs. Burden Statement: Burden in this context means the time expended by persons to generate, maintain, retain, disclose or provide the information requested. This includes the time needed to review instructions; to develop, acquire, install, and utilize technology and systems for the purpose of collecting, validating, and verifying information, processing and maintaining information, and disclosing and providing information; to train personnel and to be able to respond to a collection of information; to search data sources; to complete and review the collection of information; and to transmit or otherwise disclose the information. The total annual burden hours estimated for this Information Collection Request are summarized in the table below. ACTION: Notice. The National Cancer Institute, an institute of the National Institutes of Health, Department of Health and Human Services, is contemplating the grant of an Exclusive Patent License to SUMMARY: VerDate Sep<11>2014 17:29 Jan 02, 2020 Jkt 250001 PO 00000 Frm 00030 Fmt 4703 Sfmt 4703 3′) for the treatment, prevention, and diagnosis of hematological cancers (e.g. lymphoma, leukemia, multiple myeloma), excluding uses in combination with radiotherapy’’, and 84 FR 1764, which was a Prospective Grant of an Exclusive Patent License to Morphiex for the field of use ‘‘the use of the CD47 phosphorodiamidate morpholino oligomers (PMO, morpholino, Sequence: 5′CGTCACAGGCAGGACCCACTGCCCA3′) for the treatment, prevention, and diagnosis of hematological cancers (e.g. lymphoma, leukemia, multiple myeloma), excluding uses in combination with radiotherapy.’’ Intellectual Property 1. Provisional Patent Application No. 61/ 621,994, filed April 9, 2012, now abandoned (HHS Ref. No. E–086–2012–0–US–01); 2. Provisional Patent Application No. 61/ 735,701, filed December 11, 2012, now abandoned (HHS Ref. No. E–086–2012–1– US–01); 3. PCT Patent Application No. PCT/ US2013/035838, filed April 9, 2013, now abandoned (HHS Ref. No. E–086–2012–2– PCT–01); 4. Australian Patent No. 2013246040, issued March 14, 2019, filed April 9, 2013 (HHS Ref. No. E–086–2012–2–AU–02); 5. Canadian Patent No. 2869913, issued September 10, 2019, filed April 9, 2013 (HHS Ref. No. E–086–2012–2–CA–03); E:\FR\FM\03JAN1.SGM 03JAN1

Agencies

[Federal Register Volume 85, Number 2 (Friday, January 3, 2020)]
[Notices]
[Pages 325-326]
From the Federal Register Online via the Government Publishing Office [www.gpo.gov]
[FR Doc No: 2019-28368]


-----------------------------------------------------------------------

DEPARTMENT OF HEALTH AND HUMAN SERVICES

Health Resources and Services Administration


Agency Information Collection Activities: Proposed Collection: 
Public Comment Request; Information Collection Request Title: The 
National Health Service Corps and Nurse Corps Interest Capture Form OMB 
No. 0915-0337--Extension

AGENCY: Health Resources and Services Administration (HRSA), Department 
of Health and Human Services.

ACTION: Notice.

-----------------------------------------------------------------------

SUMMARY: In compliance with the requirement for opportunity for public 
comment on proposed data collection projects of the Paperwork Reduction 
Act of 1995, HRSA announces plans to submit an Information Collection 
Request (ICR), described below, to the Office of Management and Budget 
(OMB). Prior to submitting the ICR to OMB, HRSA seeks comments from the 
public regarding the burden estimate, below, or any other aspect of the 
ICR.

DATES: Comments on this ICR should be received no later than March 3, 
2020.

ADDRESSES: Submit your comments to [email protected] or mail the HRSA 
Information Collection Clearance Officer, Room 14N136B, 5600 Fishers 
Lane, Rockville, MD 20857.

FOR FURTHER INFORMATION CONTACT: To request more information on the 
proposed project or to obtain a copy of the data collection plans and 
draft instruments, email [email protected] or call Lisa Wright-
Solomon, the HRSA Information Collection Clearance Officer at (301) 
443-1984.

SUPPLEMENTARY INFORMATION: When submitting comments or requesting 
information, please include the information request collection title 
for reference.
    Information Collection Request Title: The National Health Service 
Corps and Nurse Corps Interest Capture Form OMB No. 0915-0337--
Extension
    Abstract: The National Health Service Corps (NHSC) and the Nurse 
Corps of

[[Page 326]]

the Bureau of Health Workforce (BHW), HRSA, are both committed to 
improving the health of the Nation's underserved by uniting communities 
in need with caring health professionals and by supporting communities' 
efforts to build better systems of care. The NHSC and Nurse Corps 
Interest Capture Form, which is used when HRSA staff presents 
information regarding HRSA funding opportunities for health profession 
students and providers at national and regional conferences and at 
campus recruiting events, is an optional form that a health profession 
student, licensed clinician, faculty member, or clinical site 
administrator can complete and submit to BHW representatives at an 
event. The purpose of the form is to enable individuals and clinical 
sites to ask BHW for periodic program updates and other general 
information regarding opportunities with the NHSC and/or the Nurse 
Corps via email. Completed forms contain information such as the names 
of the individuals, their email address(es), their city and state, the 
organization where they are employed (or the school which they attend), 
the year they intend to graduate (if applicable), how they heard about 
the NHSC/Nurse Corps, and the programs in which they are interested. 
Assistance in completing the form will be given by the BHW staff person 
(or BHW representative) who is present at the event.
    Need and Proposed Use of the Information: The need and purpose of 
this information collection is to share resources and information 
regarding the NHSC and Nurse Corps programs with interested conference/
event participants.
    Likely Respondents: Individual and potential service site 
conference/event participants interested in the NHSC or Nurse Corps 
programs.
    Burden Statement: Burden in this context means the time expended by 
persons to generate, maintain, retain, disclose or provide the 
information requested. This includes the time needed to review 
instructions; to develop, acquire, install, and utilize technology and 
systems for the purpose of collecting, validating, and verifying 
information, processing and maintaining information, and disclosing and 
providing information; to train personnel and to be able to respond to 
a collection of information; to search data sources; to complete and 
review the collection of information; and to transmit or otherwise 
disclose the information. The total annual burden hours estimated for 
this Information Collection Request are summarized in the table below.

----------------------------------------------------------------------------------------------------------------
                                                     Number of                    Average burden
            Form name                Number of     responses per       Total       per response    Total burden
                                    respondents     respondent       responses      (in hours)         hours
----------------------------------------------------------------------------------------------------------------
NHSC and Nurse Corps Interest              2,400               1           2,400            .025              60
 Capture Form...................
                                 -------------------------------------------------------------------------------
    Total.......................           2,400  ..............           2,400  ..............              60
----------------------------------------------------------------------------------------------------------------

    HRSA specifically requests comments on (1) the necessity and 
utility of the proposed information collection for the proper 
performance of the agency's functions, (2) the accuracy of the 
estimated burden, and (3) ways to enhance the quality, utility, and 
clarity of the information to be collected.

Maria G. Button,
Director, Executive Secretariat.
[FR Doc. 2019-28368 Filed 1-2-20; 8:45 am]
 BILLING CODE 4165-15-P