Prospective Grant of an Exclusive Patent License: Use of the CD47 Phosphorodiamidate Morpholino Oligomers for the Treatment, Prevention, and Diagnosis of Solid Tumors, 326-327 [2019-28355]
Download as PDF
<![CDATA[
326
Federal Register / Vol. 85, No. 2 / Friday, January 3, 2020 / Notices
the Bureau of Health Workforce (BHW),
HRSA, are both committed to improving
the health of the Nation’s underserved
by uniting communities in need with
caring health professionals and by
supporting communities’ efforts to build
better systems of care. The NHSC and
Nurse Corps Interest Capture Form,
which is used when HRSA staff presents
information regarding HRSA funding
opportunities for health profession
students and providers at national and
regional conferences and at campus
recruiting events, is an optional form
that a health profession student,
licensed clinician, faculty member, or
clinical site administrator can complete
and submit to BHW representatives at
an event. The purpose of the form is to
enable individuals and clinical sites to
ask BHW for periodic program updates
and other general information regarding
opportunities with the NHSC and/or the
Nurse Corps via email. Completed forms
contain information such as the names
of the individuals, their email
address(es), their city and state, the
organization where they are employed
(or the school which they attend), the
year they intend to graduate (if
applicable), how they heard about the
NHSC/Nurse Corps, and the programs in
which they are interested. Assistance in
completing the form will be given by the
BHW staff person (or BHW
representative) who is present at the
event.
Need and Proposed Use of the
Information: The need and purpose of
this information collection is to share
resources and information regarding the
NHSC and Nurse Corps programs with
interested conference/event
participants.
Likely Respondents: Individual and
potential service site conference/event
Number of
respondents
Form name
Number of
responses per
respondent
Total
responses
Average
burden per
response
(in hours)
Total burden
hours
NHSC and Nurse Corps Interest Capture Form .................
2,400
1
2,400
.025
60
Total ..............................................................................
2,400
........................
2,400
........................
60
HRSA specifically requests comments
on (1) the necessity and utility of the
proposed information collection for the
proper performance of the agency’s
functions, (2) the accuracy of the
estimated burden, and (3) ways to
enhance the quality, utility, and clarity
of the information to be collected.
Maria G. Button,
Director, Executive Secretariat.
[FR Doc. 2019–28368 Filed 1–2–20; 8:45 am]
BILLING CODE 4165–15–P
practice the inventions embodied in the
Patents and Patent Applications listed
in the Supplementary Information
section of this notice to Morphiex
Biotherapeutics (‘‘Morphiex’’) located in
Boston, MA.
DATES: Only written comments and/or
applications for a license which are
received by the National Cancer
Institute’s Technology Transfer Center
on or before January 21, 2020 will be
considered.
Requests for copies of the
patent application, inquiries, and
comments relating to the contemplated
an Exclusive Patent License should be
directed to: Jaime Greene, Senior
Licensing and Patenting Manager, NCI
Technology Transfer Center, 9609
Medical Center Drive, RM 1E530, MSC
9702, Bethesda, MD 20892–9702 (for
business mail), Rockville, MD 20850–
9702, Telephone: (240) 276–5530;
Facsimile: (240) 276–5504; Email:
greenejaime@mail.nih.gov.
SUPPLEMENTARY INFORMATION: This is in
reference to previous notices 83 FR
22501, which was a Prospective Grant of
an Exclusive Patent License to
Morphiex for the field of use ‘‘the use
of the CD47 phosphorodiamidate
morpholino oligomers (PMO,
morpholino, Sequence: 5′CGTCACAGGCAGGACCCACTGCCCAADDRESSES:
DEPARTMENT OF HEALTH AND
HUMAN SERVICES
National Institutes of Health
Prospective Grant of an Exclusive
Patent License: Use of the CD47
Phosphorodiamidate Morpholino
Oligomers for the Treatment,
Prevention, and Diagnosis of Solid
Tumors
AGENCY:
National Institutes of Health,
HHS.
jbell on DSKJLSW7X2PROD with NOTICES
participants interested in the NHSC or
Nurse Corps programs.
Burden Statement: Burden in this
context means the time expended by
persons to generate, maintain, retain,
disclose or provide the information
requested. This includes the time
needed to review instructions; to
develop, acquire, install, and utilize
technology and systems for the purpose
of collecting, validating, and verifying
information, processing and
maintaining information, and disclosing
and providing information; to train
personnel and to be able to respond to
a collection of information; to search
data sources; to complete and review
the collection of information; and to
transmit or otherwise disclose the
information. The total annual burden
hours estimated for this Information
Collection Request are summarized in
the table below.
ACTION:
Notice.
The National Cancer Institute,
an institute of the National Institutes of
Health, Department of Health and
Human Services, is contemplating the
grant of an Exclusive Patent License to
SUMMARY:
VerDate Sep<11>2014
17:29 Jan 02, 2020
Jkt 250001
PO 00000
Frm 00030
Fmt 4703
Sfmt 4703
3′) for the treatment, prevention, and
diagnosis of hematological cancers (e.g.
lymphoma, leukemia, multiple
myeloma), excluding uses in
combination with radiotherapy’’, and 84
FR 1764, which was a Prospective Grant
of an Exclusive Patent License to
Morphiex for the field of use ‘‘the use
of the CD47 phosphorodiamidate
morpholino oligomers (PMO,
morpholino, Sequence: 5′CGTCACAGGCAGGACCCACTGCCCA3′) for the treatment, prevention, and
diagnosis of hematological cancers (e.g.
lymphoma, leukemia, multiple
myeloma), excluding uses in
combination with radiotherapy.’’
Intellectual Property
1. Provisional Patent Application No. 61/
621,994, filed April 9, 2012, now abandoned
(HHS Ref. No. E–086–2012–0–US–01);
2. Provisional Patent Application No. 61/
735,701, filed December 11, 2012, now
abandoned (HHS Ref. No. E–086–2012–1–
US–01);
3. PCT Patent Application No. PCT/
US2013/035838, filed April 9, 2013, now
abandoned (HHS Ref. No. E–086–2012–2–
PCT–01);
4. Australian Patent No. 2013246040,
issued March 14, 2019, filed April 9, 2013
(HHS Ref. No. E–086–2012–2–AU–02);
5. Canadian Patent No. 2869913, issued
September 10, 2019, filed April 9, 2013 (HHS
Ref. No. E–086–2012–2–CA–03);
E:\FR\FM\03JAN1.SGM
03JAN1
Federal Register / Vol. 85, No. 2 / Friday, January 3, 2020 / Notices
jbell on DSKJLSW7X2PROD with NOTICES
6. European Patent No. 2836591, issued
June 6, 2018, filed April 9, 2013 (HHS Ref.
No. E–086–2012–2–EP–04);
7. US Patent No. 10407665, issued
September 10, 2019, filed October 2, 2014
(HHS Ref. No. E–086–2012–2–US–05);
8. German Patent No. 2836591, issued June
6, 2018, filed April 9, 2013 (HHS Ref. No. E–
086–2012–2–DE–07);
9. French Patent No. 2836591, issued June
6, 2018, filed April 9, 2013 (HHS Ref. No. E–
086–2012–2–FR–08);
10. United Kingdom Patent No. 2836591,
issued June 6, 2018, filed April 9, 2013 (HHS
Ref. No. E–086–2012–2–GB–09);
11. US Patent Application No. 16/521,251,
filed July 24, 2019 (HHS Ref. No. E–086–
2012–2–US–10);
12. Provisional Patent Application No. 61/
086,991, filed August 7, 2008, now
abandoned (HHS Ref. No. E–153–2008–0–
US–01);
13. PCT Patent Application No. PCT/
US2009/052902, filed August 5, 2009, now
abandoned (HHS Ref. No. E–153–2008–0–
PCT–02);
14. Australian Patent No. 2009279676,
issued July 30, 2015, filed August 5, 2009
(HHS Ref. No. E–153–2008–0–AU–03);
15. Canadian Patent No. 2732102, issued
January 2, 2018, filed August 5, 2009 (HHS
Ref. No. E–153–2008–0–CA–04);
16. European Patent No. 2340034, issued
January 27, 2016, filed August 5, 2009 (HHS
Ref. No. E–153–2008–0–EP–05);
17. US Patent No. 8951527, issued
February 10, 2015, filed February 3, 2011
(HHS Ref. No. E–153–2008–0–US–06);
18. German Patent No. 602009036069.8,
issued January 27, 2016, filed August 5, 2009
(HHS Ref. No. E–153–2008–0–DE–07);
19. French Patent No. 2340034, issued
January 27, 2016, filed August 5, 2009 (HHS
Ref. No. E–153–2008–0–FR–08);
20. United Kingdom Patent No. 2340034,
issued January 27, 2016, filed August 5, 2009
(HHS Ref. No. E–153–2008–0–GB–09);
21. Provisional Patent Application No. 61/
779,587, filed March 13, 2013, now
abandoned (HHS Ref. No. E–296–2011–0–
US–01);
22. PCT Patent Application No. PCT/
US2014/025989, filed March 13, 2014, now
abandoned (HHS Ref. No. E–296–2011–0–
PCT–02);
23. Australian Patent No. 2014244083,
issued January 10, 2019, filed March 13,
2014, now abandoned (HHS Ref. No. E–296–
2011–0–AU–03);
24. Canadian Patent Application No.
2905418, filed March 13, 2014 (HHS Ref. No.
E–296–2011–0–CA–04);
25. European Patent Application No.
14718255.4, filed March 13, 2014 (HHS Ref.
No. E–296–2011–0–EP–05);
26. US Patent Application No. 14/775,428,
filed September 11, 2015 (HHS Ref. No. E–
296–2011–0–US–06).
The patent rights in these inventions
have been assigned and/or exclusively
licensed to the government of the
United States of America. The
prospective exclusive license territory
may be worldwide, and the field of use
may be limited to those previously
VerDate Sep<11>2014
17:29 Jan 02, 2020
Jkt 250001
advertised in Federal Register notices
83 FR 22501 84 FR 1764, described in
the supplementary information section
above.
This technology concerns CD47,
originally named integrin-associated
protein, which is a receptor for
thrombospondin-1 (TSP1), a major
component of platelet a-granules from
which it is secreted on platelet
activation. A number of important roles
for CD47 have been defined in
regulating the migration, proliferation,
and survival of vascular cells, and in
regulation of innate and adaptive
immunity. Nitric Oxide (NO) plays an
important role as a major intrinsic
vasodilator, and it increases blood flow
to tissues and organs. Disruption of this
process leads to peripheral vascular
disease, ischemic heart disease, stroke,
diabetes and many more significant
diseases. The inventors have discovered
that TSP1 blocks the beneficial effects of
NO and prevents it from dilating blood
vessels and increasing blood flow to
organs and tissues. Additionally, they
discovered that this regulation requires
TSP1 interaction with its cell receptor,
CD47. These inventors have also found
that blocking TSP1–CD47 interaction
through the use of antisense morpholino
oligonucleotides, peptides or antibodies
have several therapeutic benefits
including the treatment of cancer.
This notice is made in accordance
with 35 U.S.C. 209 and 37 CFR part 404.
The prospective exclusive license will
be royalty bearing, and the prospective
exclusive license may be granted unless
within fifteen (15) days from the date of
this published notice, the National
Cancer Institute receives written
evidence and argument that establishes
that the grant of the license would not
be consistent with the requirements of
35 U.S.C. 209 and 37 CFR part 404.
In response to this Notice, the public
may file comments or objections.
Comments and objections, other than
those in the form of a license
application, will not be treated
confidentially, and may be made
publicly available.
License applications submitted in
response to this Notice will be
presumed to contain business
confidential information and any release
of information in these license
applications will be made only as
required and upon a request under the
Freedom of Information Act, 5 U.S.C.
552.
PO 00000
Frm 00031
Fmt 4703
Sfmt 4703
327
Dated: December 20, 2019.
Richard U. Rodriguez,
Associate Director, Technology Transfer
Center, National Cancer Institute.
[FR Doc. 2019–28355 Filed 1–2–20; 8:45 am]
BILLING CODE 4140–01–P
DEPARTMENT OF HEALTH AND
HUMAN SERVICES
National Institutes of Health
Government-Owned Inventions;
Availability for Licensing
National Institutes of Health.
Notice.
AGENCY:
ACTION:
The invention listed below is
owned by an agency of the U.S.
Government and is available for
licensing to achieve expeditious
commercialization of results of
federally-funded research and
development.
FOR FURTHER INFORMATION CONTACT:
Licensing information may be obtained
by communicating with Vidita
Choudhry, Ph.D., National Heart, Lung,
and Blood, Office of Technology
Transfer and Development, 31 Center
Drive, Room 4A29, MSC2479, Bethesda,
MD 20892–2479; telephone: 301–594–
4095; email: vidita.choudhry@nih.gov.
A signed Confidential Disclosure
Agreement may be required to receive
any unpublished information.
SUPPLEMENTARY INFORMATION:
Technology description follows.
SUMMARY:
Therapeutic and Diagnostic Targets for
Severe RSV Infection
Respiratory Syncytial Virus (RSV)
infects nearly all children by their
second birthday. RSV usually causes
mild respiratory illness, however, a
subset of patients experience severe
infection that require hospitalization.
Successful host defense against viral
pathogens requires rapid recognition of
the virus and activation of both innate
and adaptive immunity. Toll-Like
Receptors (TLRs) are responsible for
mounting an innate immune response
and genetic variations within TLRs
modulate severity of infection.
Researchers at NIEHS have identified a
single nucleotide polymorphism (SNP)
in TLR8 that is associated with RSV
disease severity. The SNP is p53responsive allele, indicating that p53, a
master cell cycle regulator, can strongly
influence TLR8 mediated immune
responses. Identification of this SNP can
inform diagnosis and prognosis of RSV
disease and serve as a therapeutic target
for severe RSV infection.
Potential Commercial Applications:
E:\FR\FM\03JAN1.SGM
03JAN1
]]>Agencies
[Federal Register Volume 85, Number 2 (Friday, January 3, 2020)]
[Notices]
[Pages 326-327]
From the Federal Register Online via the Government Publishing Office [www.gpo.gov]
[FR Doc No: 2019-28355]
-----------------------------------------------------------------------
DEPARTMENT OF HEALTH AND HUMAN SERVICES
National Institutes of Health
Prospective Grant of an Exclusive Patent License: Use of the CD47
Phosphorodiamidate Morpholino Oligomers for the Treatment, Prevention,
and Diagnosis of Solid Tumors
AGENCY: National Institutes of Health, HHS.
ACTION: Notice.
-----------------------------------------------------------------------
SUMMARY: The National Cancer Institute, an institute of the National
Institutes of Health, Department of Health and Human Services, is
contemplating the grant of an Exclusive Patent License to practice the
inventions embodied in the Patents and Patent Applications listed in
the Supplementary Information section of this notice to Morphiex
Biotherapeutics (``Morphiex'') located in Boston, MA.
DATES: Only written comments and/or applications for a license which
are received by the National Cancer Institute's Technology Transfer
Center on or before January 21, 2020 will be considered.
ADDRESSES: Requests for copies of the patent application, inquiries,
and comments relating to the contemplated an Exclusive Patent License
should be directed to: Jaime Greene, Senior Licensing and Patenting
Manager, NCI Technology Transfer Center, 9609 Medical Center Drive, RM
1E530, MSC 9702, Bethesda, MD 20892-9702 (for business mail),
Rockville, MD 20850-9702, Telephone: (240) 276-5530; Facsimile: (240)
276-5504; Email: [email protected].
SUPPLEMENTARY INFORMATION: This is in reference to previous notices 83
FR 22501, which was a Prospective Grant of an Exclusive Patent License
to Morphiex for the field of use ``the use of the CD47
phosphorodiamidate morpholino oligomers (PMO, morpholino, Sequence: 5'-
CGTCACAGGCAGGACCCACTGCCCA-3') for the treatment, prevention, and
diagnosis of hematological cancers (e.g. lymphoma, leukemia, multiple
myeloma), excluding uses in combination with radiotherapy'', and 84 FR
1764, which was a Prospective Grant of an Exclusive Patent License to
Morphiex for the field of use ``the use of the CD47 phosphorodiamidate
morpholino oligomers (PMO, morpholino, Sequence: 5'-
CGTCACAGGCAGGACCCACTGCCCA-3') for the treatment, prevention, and
diagnosis of hematological cancers (e.g. lymphoma, leukemia, multiple
myeloma), excluding uses in combination with radiotherapy.''
Intellectual Property
1. Provisional Patent Application No. 61/621,994, filed April 9,
2012, now abandoned (HHS Ref. No. E-086-2012-0-US-01);
2. Provisional Patent Application No. 61/735,701, filed December
11, 2012, now abandoned (HHS Ref. No. E-086-2012-1-US-01);
3. PCT Patent Application No. PCT/US2013/035838, filed April 9,
2013, now abandoned (HHS Ref. No. E-086-2012-2-PCT-01);
4. Australian Patent No. 2013246040, issued March 14, 2019,
filed April 9, 2013 (HHS Ref. No. E-086-2012-2-AU-02);
5. Canadian Patent No. 2869913, issued September 10, 2019, filed
April 9, 2013 (HHS Ref. No. E-086-2012-2-CA-03);
[[Page 327]]
6. European Patent No. 2836591, issued June 6, 2018, filed April
9, 2013 (HHS Ref. No. E-086-2012-2-EP-04);
7. US Patent No. 10407665, issued September 10, 2019, filed
October 2, 2014 (HHS Ref. No. E-086-2012-2-US-05);
8. German Patent No. 2836591, issued June 6, 2018, filed April
9, 2013 (HHS Ref. No. E-086-2012-2-DE-07);
9. French Patent No. 2836591, issued June 6, 2018, filed April
9, 2013 (HHS Ref. No. E-086-2012-2-FR-08);
10. United Kingdom Patent No. 2836591, issued June 6, 2018,
filed April 9, 2013 (HHS Ref. No. E-086-2012-2-GB-09);
11. US Patent Application No. 16/521,251, filed July 24, 2019
(HHS Ref. No. E-086-2012-2-US-10);
12. Provisional Patent Application No. 61/086,991, filed August
7, 2008, now abandoned (HHS Ref. No. E-153-2008-0-US-01);
13. PCT Patent Application No. PCT/US2009/052902, filed August
5, 2009, now abandoned (HHS Ref. No. E-153-2008-0-PCT-02);
14. Australian Patent No. 2009279676, issued July 30, 2015,
filed August 5, 2009 (HHS Ref. No. E-153-2008-0-AU-03);
15. Canadian Patent No. 2732102, issued January 2, 2018, filed
August 5, 2009 (HHS Ref. No. E-153-2008-0-CA-04);
16. European Patent No. 2340034, issued January 27, 2016, filed
August 5, 2009 (HHS Ref. No. E-153-2008-0-EP-05);
17. US Patent No. 8951527, issued February 10, 2015, filed
February 3, 2011 (HHS Ref. No. E-153-2008-0-US-06);
18. German Patent No. 602009036069.8, issued January 27, 2016,
filed August 5, 2009 (HHS Ref. No. E-153-2008-0-DE-07);
19. French Patent No. 2340034, issued January 27, 2016, filed
August 5, 2009 (HHS Ref. No. E-153-2008-0-FR-08);
20. United Kingdom Patent No. 2340034, issued January 27, 2016,
filed August 5, 2009 (HHS Ref. No. E-153-2008-0-GB-09);
21. Provisional Patent Application No. 61/779,587, filed March
13, 2013, now abandoned (HHS Ref. No. E-296-2011-0-US-01);
22. PCT Patent Application No. PCT/US2014/025989, filed March
13, 2014, now abandoned (HHS Ref. No. E-296-2011-0-PCT-02);
23. Australian Patent No. 2014244083, issued January 10, 2019,
filed March 13, 2014, now abandoned (HHS Ref. No. E-296-2011-0-AU-
03);
24. Canadian Patent Application No. 2905418, filed March 13,
2014 (HHS Ref. No. E-296-2011-0-CA-04);
25. European Patent Application No. 14718255.4, filed March 13,
2014 (HHS Ref. No. E-296-2011-0-EP-05);
26. US Patent Application No. 14/775,428, filed September 11,
2015 (HHS Ref. No. E-296-2011-0-US-06).
The patent rights in these inventions have been assigned and/or
exclusively licensed to the government of the United States of America.
The prospective exclusive license territory may be worldwide, and the
field of use may be limited to those previously advertised in Federal
Register notices 83 FR 22501 84 FR 1764, described in the supplementary
information section above.
This technology concerns CD47, originally named integrin-associated
protein, which is a receptor for thrombospondin-1 (TSP1), a major
component of platelet [alpha]-granules from which it is secreted on
platelet activation. A number of important roles for CD47 have been
defined in regulating the migration, proliferation, and survival of
vascular cells, and in regulation of innate and adaptive immunity.
Nitric Oxide (NO) plays an important role as a major intrinsic
vasodilator, and it increases blood flow to tissues and organs.
Disruption of this process leads to peripheral vascular disease,
ischemic heart disease, stroke, diabetes and many more significant
diseases. The inventors have discovered that TSP1 blocks the beneficial
effects of NO and prevents it from dilating blood vessels and
increasing blood flow to organs and tissues. Additionally, they
discovered that this regulation requires TSP1 interaction with its cell
receptor, CD47. These inventors have also found that blocking TSP1-CD47
interaction through the use of antisense morpholino oligonucleotides,
peptides or antibodies have several therapeutic benefits including the
treatment of cancer.
This notice is made in accordance with 35 U.S.C. 209 and 37 CFR
part 404. The prospective exclusive license will be royalty bearing,
and the prospective exclusive license may be granted unless within
fifteen (15) days from the date of this published notice, the National
Cancer Institute receives written evidence and argument that
establishes that the grant of the license would not be consistent with
the requirements of 35 U.S.C. 209 and 37 CFR part 404.
In response to this Notice, the public may file comments or
objections. Comments and objections, other than those in the form of a
license application, will not be treated confidentially, and may be
made publicly available.
License applications submitted in response to this Notice will be
presumed to contain business confidential information and any release
of information in these license applications will be made only as
required and upon a request under the Freedom of Information Act, 5
U.S.C. 552.
Dated: December 20, 2019.
Richard U. Rodriguez,
Associate Director, Technology Transfer Center, National Cancer
Institute.
[FR Doc. 2019-28355 Filed 1-2-20; 8:45 am]
BILLING CODE 4140-01-P
