National Institute of General Medical Sciences; Notice of Closed Meeting, 1764 [2019-01091]

Download as PDF 1764 Federal Register / Vol. 84, No. 24 / Tuesday, February 5, 2019 / Notices DEPARTMENT OF HEALTH AND HUMAN SERVICES DEPARTMENT OF HEALTH AND HUMAN SERVICES DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institutes of Health National Institutes of Health National Institute of General Medical Sciences; Notice of Closed Meeting National Institute of Diabetes and Digestive and Kidney Diseases; Notice of Closed Meeting Prospective Grant of an Exclusive Patent License: Use of the CD47 Phosphorodiamidate Morpholino Oligomers for the Treatment, Prevention, and Diagnosis of Solid Tumors Pursuant to section 10(d) of the Federal Advisory Committee Act, as amended, notice is hereby given of the following meeting. The meeting will be closed to the public in accordance with the provisions set forth in sections 552b(c)(4) and 552b(c)(6), Title 5 U.S.C., as amended. The grant applications and the discussions could disclose confidential trade secrets or commercial property such as patentable material, and personal information concerning individuals associated with the grant applications, the disclosure of which would constitute a clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of General Medical Sciences Special Emphasis Panel; Review of PRAT Fellowship Applications. Date: February 28, 2019. Time: 8:00 a.m. to 5:00 p.m. Agenda: To review and evaluate grant applications. Place: Embassy Suites at Chevy Chase Pavilion, 4300 Military Road NW, Washington, DC 20015. Contact Person: John J. Laffan, Scientific Review Officer, Office of Scientific Review, National Institute of General Medical Sciences, National Institutes of Health, Natcher Building, Room 3AN18J, Bethesda, MD 20892, 301–594–2773, laffanjo@ mail.nih.gov. (Catalogue of Federal Domestic Assistance Program Nos. 93.375, Minority Biomedical Research Support; 93.821, Cell Biology and Biophysics Research; 93.859, Pharmacology, Physiology, and Biological Chemistry Research; 93.862, Genetics and Developmental Biology Research; 93.88, Minority Access to Research Careers; 93.96, Special Minority Initiatives; 93.859, Biomedical Research and Research Training, National Institutes of Health, HHS) Dated: January 30, 2019. Melanie J. Pantoja, Program Analyst, Office of Federal Advisory Committee Policy. Pursuant to section 10(d) of the Federal Advisory Committee Act, as amended, notice is hereby given of the following meeting. The meeting will be closed to the public in accordance with the provisions set forth in sections 552b(c)(4) and 552b(c)(6), Title 5 U.S.C., as amended. The grant applications and the discussions could disclose confidential trade secrets or commercial property such as patentable material, and personal information concerning individuals associated with the grant applications, the disclosure of which would constitute a clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of Diabetes and Digestive and Kidney Diseases Special Emphasis Panel, P01 Program Project Review—NuBeta. Date: February 27, 2019. Time: 11:30 a.m. to 3:30 p.m. Agenda: To review and evaluate grant applications. Place: National Institutes of Health, Two Democracy Plaza, 6707 Democracy Boulevard, Bethesda, MD 20892, (Telephone Conference Call). Contact Person: Charlene J. Repique, Ph.D., Scientific Review Officer, Review Branch, DEA, NIDDK, National Institutes of Health, Room 7347, 6707 Democracy Boulevard, Bethesda, MD 20892–5452, (301) 451–3638, charlene.repique@nih.gov. (Catalogue of Federal Domestic Assistance Program Nos. 93.847, Diabetes, Endocrinology and Metabolic Research; 93.848, Digestive Diseases and Nutrition Research; 93.849, Kidney Diseases, Urology and Hematology Research, National Institutes of Health, HHS) Dated: January 30, 2019. Melanie J. Pantoja, Program Analyst, Office of Federal Advisory Committee Policy. [FR Doc. 2019–01083 Filed 2–4–19; 8:45 am] BILLING CODE 4140–01–P [FR Doc. 2019–01091 Filed 2–4–19; 8:45 am] AGENCY: National Institutes of Health, HHS. ACTION: Notice. The National Cancer Institute, an institute of the National Institutes of Health, Department of Health and Human Services, is contemplating the grant of an Exclusive Patent License to practice the inventions embodied in the Patents and Patent Applications listed in the Supplementary Information section of this notice to Morphiex Biotherapeutics (‘‘Morphiex’’) located in Boston, MA. DATES: Only written comments and/or applications for a license which are received by the National Cancer Institute’s Technology Transfer Center on or before February 20, 2019 will be considered. ADDRESSES: Requests for copies of the patent application, inquiries, and comments relating to the contemplated an Exclusive Patent License should be directed to: Jaime Greene, Senior Licensing and Patenting Manager, NCI Technology Transfer Center, 9609 Medical Center Drive, RM 1E530 MSC 9702, Bethesda, MD 20892–9702 (for business mail), Rockville, MD 20850– 9702 Telephone: (240)–276–5530; Facsimile: (240)–276–5504 Email: greenejaime@mail.nih.gov. SUPPLEMENTARY INFORMATION: This is in reference to a previous notice 83 FR 22501, which was a Prospective Grant of an Exclusive Patent License to Morphiex for the field of use ‘‘the use of the CD47 phosphorodiamidate morpholino oligomers (PMO, morpholino, Sequence: 5′CGTCACAGGCAGGACCCACTGCCCA3′) for the treatment, prevention, and diagnosis of hematological cancers (e.g. lymphoma, leukemia, multiple myeloma), excluding uses in combination with radiotherapy.’’ SUMMARY: Intellectual Property BILLING CODE 4140–01–P 1. U.S. Provisional Patent Application No. 60/850,132, filed October 6, 2006, now abandoned (HHS Ref. No. E–227– 2006/0–US–01); 2. U.S. Provisional Patent Application No. 60/864,153, filed November 02, VerDate Sep<11>2014 17:22 Feb 04, 2019 Jkt 247001 PO 00000 Frm 00067 Fmt 4703 Sfmt 4703 E:\FR\FM\05FEN1.SGM 05FEN1

Agencies

[Federal Register Volume 84, Number 24 (Tuesday, February 5, 2019)]
[Notices]
[Page 1764]
From the Federal Register Online via the Government Publishing Office [www.gpo.gov]
[FR Doc No: 2019-01091]



[[Page 1764]]

-----------------------------------------------------------------------

DEPARTMENT OF HEALTH AND HUMAN SERVICES

National Institutes of Health


National Institute of General Medical Sciences; Notice of Closed 
Meeting

    Pursuant to section 10(d) of the Federal Advisory Committee Act, as 
amended, notice is hereby given of the following meeting.
    The meeting will be closed to the public in accordance with the 
provisions set forth in sections 552b(c)(4) and 552b(c)(6), Title 5 
U.S.C., as amended. The grant applications and the discussions could 
disclose confidential trade secrets or commercial property such as 
patentable material, and personal information concerning individuals 
associated with the grant applications, the disclosure of which would 
constitute a clearly unwarranted invasion of personal privacy.

    Name of Committee: National Institute of General Medical 
Sciences Special Emphasis Panel; Review of PRAT Fellowship 
Applications.
    Date: February 28, 2019.
    Time: 8:00 a.m. to 5:00 p.m.
    Agenda: To review and evaluate grant applications.
    Place: Embassy Suites at Chevy Chase Pavilion, 4300 Military 
Road NW, Washington, DC 20015.
    Contact Person: John J. Laffan, Scientific Review Officer, 
Office of Scientific Review, National Institute of General Medical 
Sciences, National Institutes of Health, Natcher Building, Room 
3AN18J, Bethesda, MD 20892, 301-594-2773, laffanjo@mail.nih.gov.

(Catalogue of Federal Domestic Assistance Program Nos. 93.375, 
Minority Biomedical Research Support; 93.821, Cell Biology and 
Biophysics Research; 93.859, Pharmacology, Physiology, and 
Biological Chemistry Research; 93.862, Genetics and Developmental 
Biology Research; 93.88, Minority Access to Research Careers; 93.96, 
Special Minority Initiatives; 93.859, Biomedical Research and 
Research Training, National Institutes of Health, HHS)

    Dated: January 30, 2019.
Melanie J. Pantoja,
Program Analyst, Office of Federal Advisory Committee Policy.
[FR Doc. 2019-01091 Filed 2-4-19; 8:45 am]
 BILLING CODE 4140-01-P
This site is protected by reCAPTCHA and the Google Privacy Policy and Terms of Service apply.