National Institute of Diabetes and Digestive and Kidney Diseases; Notice of Closed Meeting, 1765 [2019-01086]
Download as PDF
<![CDATA[
Federal Register / Vol. 84, No. 24 / Tuesday, February 5, 2019 / Notices
2006, now abandoned (HHS Ref. No. E–
227–2006/1–US–01);
3. U.S. Provisional Patent Application
No. 60/888,754, filed February 07, 2007,
now abandoned (HHS Ref. No. E–227–
2006/2–US–01);
4. U.S. Provisional Patent Application
No. 60/910,549, filed April 06, 2007,
now abandoned (HHS Ref. No. E–227–
2006/3–US–01);
5. U.S. Provisional Patent Application
No. 60/956,375, filed August 16, 2007,
now abandoned (HHS Ref. No. E–227–
2006/4–US–01);
6. PCT Patent Application No. PCT/
2007/080647, filed October 5, 2007, now
abandoned (HHS Ref. No. E–227–2006/
5–PCT–01);
7. U.S. Patent No. 8,236,313, filed
April 3, 2009, Issued August 7, 2012
(HHS Ref. No. E–227–2006/5–US–02);
8. Canadian Patent Application No.
2,665,287, October 5, 2007 (HHS Ref.
No. E–227–2006/5–CA–03);
9. Australian Patent No. 2007319576,
filed October 5, 2007, Issued May 1,
2014 (HHS Ref. No. E–227–2006/5–AU–
04);
10. European Patent Application No.
07868382.8, filed March 27, 2009 (HHS
Ref. No. E–227–2006/5–EP–05);
11. U.S. Patent Application No. 13/
546,931, filed July 11, 2012 (HHS Ref.
No. E–227–2006/5–US–06);
12. U.S. Patent Number 8,557,788,
filed July 11, 2012, Issued October 15,
2013 (HHS Ref. No. E–227–2006/5–US–
07);
13. European Patent Application No.
13180563.2, filed October 5, 2007 (HHS
Ref. No. E–227–2006/5–EP–08);
14. Australian Patent No. 2014201936,
filed October 5, 2007, Issued October 20,
2016 (HHS Ref. No. E–227–2006/5–AU–
09);
15. U.S. Patent Application No. 14/
500,861, filed September 29, 2014 (HHS
Ref. No. E–227–2006/5–US–10);
16. Australian Patent No. 2016238894,
filed October 6, 2016, Issued February
22, 2018 (HHS Ref. No. E–227–2006/5–
AU–11); and
17. Australian Patent Application No.
2018200921, filed February 8, 2018
(HHS Ref. No. E–227–2006/5–AU–12).
The patent rights in these inventions
have been assigned and/or exclusively
licensed to the government of the
United States of America.
The prospective exclusive license
territory may be worldwide, and the
field of use may be limited to: ‘‘The use
of the CD47 phosphorodiamidate
morpholino oligomers (PMO,
morpholino, Sequence: 5′CGTCACAGGCAGGACCCACTGCCCA3′) for the treatment, prevention, and
diagnosis of solid tumors, excluding
uses in combination with radiotherapy.’’
VerDate Sep<11>2014
17:22 Feb 04, 2019
Jkt 247001
This technology concerns CD47,
originally named integrin-associated
protein, which is a receptor for
thrombospondin-1 (TSP1), a major
component of platelet a-granules from
which it is secreted on platelet
activation. A number of important roles
for CD47 have been defined in
regulating the migration, proliferation,
and survival of vascular cells, and in
regulation of innate and adaptive
immunity. Nitric Oxide (NO) plays an
important role as a major intrinsic
vasodilator, and it increases blood flow
to tissues and organs. Disruption of this
process leads to peripheral vascular
disease, ischemic heart disease, stroke,
diabetes and many more significant
diseases. The inventors have discovered
that TSP1 blocks the beneficial effects of
NO and prevents it from dilating blood
vessels and increasing blood flow to
organs and tissues. Additionally, they
discovered that this regulation requires
TSP1 interaction with its cell receptor,
CD47. These inventors have also found
that blocking TSP1-CD47 interaction
through the use of antisense morpholino
oligonucleotides, peptides or antibodies
have several therapeutic benefits
including the treatment of cancer.
This notice is made in accordance
with 35 U.S.C. 209 and 37 CFR part 404.
The prospective exclusive license will
be royalty bearing, and the prospective
exclusive license may be granted unless
within fifteen (15) days from the date of
this published notice, the National
Cancer Institute receives written
evidence and argument that establishes
that the grant of the license would not
be consistent with the requirements of
35 U.S.C. 209 and 37 CFR part 404.
In response to this Notice, the public
may file comments or objections.
Comments and objections, other than
those in the form of a license
application, will not be treated
confidentially, and may be made
publicly available.
License applications submitted in
response to this Notice will be
presumed to contain business
confidential information and any release
of information in these license
applications will be made only as
required and upon a request under the
Freedom of Information Act, 5 U.S.C.
552.
Dated: December 18, 2018.
Richard U. Rodriguez,
Associate Director, Technology Transfer
Center, National Cancer Institute.
[FR Doc. 2019–00909 Filed 2–4–19; 8:45 am]
BILLING CODE 4140–01–P
PO 00000
Frm 00068
Fmt 4703
Sfmt 4703
1765
DEPARTMENT OF HEALTH AND
HUMAN SERVICES
National Institutes of Health
National Institute of Diabetes and
Digestive and Kidney Diseases; Notice
of Closed Meeting
Pursuant to section 10(d) of the
Federal Advisory Committee Act, as
amended, notice is hereby given of a
meeting of the Board of Scientific
Counselors, NIDDK.
The meeting will be closed to the
public as indicated below in accordance
with the provisions set forth in section
552b(c)(6), Title 5 U.S.C., as amended
for the review, discussion, and
evaluation of individual intramural
programs and projects conducted by the
National Institute of Diabetes and
Digestive and Kidney Diseases,
including consideration of personnel
qualifications and performance, and the
competence of individual investigators,
the disclosure of which would
constitute a clearly unwarranted
invasion of personal privacy.
Name of Committee: Board of Scientific
Counselors, NIDDK.
Date: October 10–11, 2019.
Time: 8:00 a.m. to 6:00 p.m.
Agenda: To review and evaluate personal
qualifications and performance, and
competence of individual investigators.
Place: National Institutes of Health,
Building 10, Solarium Conference Room
9S233, 10 Center Drive, Bethesda, MD 20892.
Contact Person: Michael W. Krause, Ph.D.,
Scientific Director, National Institute of
Diabetes and Digestive and Kidney Diseases,
National Institute of Health, Building 5,
Room B104, Bethesda, MD 20892–1818, (301)
402–4633, mwkrause@helix.nih.gov.
(Catalogue of Federal Domestic Assistance
Program Nos. 93.847, Diabetes,
Endocrinology and Metabolic Research;
93.848, Digestive Diseases and Nutrition
Research; 93.849, Kidney Diseases, Urology
and Hematology Research, National Institutes
of Health, HHS)
Dated: January 30, 2019.
Melanie J. Pantoja,
Program Analyst, Office of Federal Advisory
Committee Policy.
[FR Doc. 2019–01086 Filed 2–4–19; 8:45 am]
BILLING CODE 4140–01–P
DEPARTMENT OF HEALTH AND
HUMAN SERVICES
National Institutes of Health
National Cancer Institute; Amended
Notice of Meeting
Notice is hereby given of a change in
the meeting of the National Cancer
Institute Special Emphasis Panel,
E:\FR\FM\05FEN1.SGM
05FEN1
]]>Agencies
[Federal Register Volume 84, Number 24 (Tuesday, February 5, 2019)]
[Notices]
[Page 1765]
From the Federal Register Online via the Government Publishing Office [www.gpo.gov]
[FR Doc No: 2019-01086]
-----------------------------------------------------------------------
DEPARTMENT OF HEALTH AND HUMAN SERVICES
National Institutes of Health
National Institute of Diabetes and Digestive and Kidney Diseases;
Notice of Closed Meeting
Pursuant to section 10(d) of the Federal Advisory Committee Act, as
amended, notice is hereby given of a meeting of the Board of Scientific
Counselors, NIDDK.
The meeting will be closed to the public as indicated below in
accordance with the provisions set forth in section 552b(c)(6), Title 5
U.S.C., as amended for the review, discussion, and evaluation of
individual intramural programs and projects conducted by the National
Institute of Diabetes and Digestive and Kidney Diseases, including
consideration of personnel qualifications and performance, and the
competence of individual investigators, the disclosure of which would
constitute a clearly unwarranted invasion of personal privacy.
Name of Committee: Board of Scientific Counselors, NIDDK.
Date: October 10-11, 2019.
Time: 8:00 a.m. to 6:00 p.m.
Agenda: To review and evaluate personal qualifications and
performance, and competence of individual investigators.
Place: National Institutes of Health, Building 10, Solarium
Conference Room 9S233, 10 Center Drive, Bethesda, MD 20892.
Contact Person: Michael W. Krause, Ph.D., Scientific Director,
National Institute of Diabetes and Digestive and Kidney Diseases,
National Institute of Health, Building 5, Room B104, Bethesda, MD
20892-1818, (301) 402-4633, mwkrause@helix.nih.gov.
(Catalogue of Federal Domestic Assistance Program Nos. 93.847,
Diabetes, Endocrinology and Metabolic Research; 93.848, Digestive
Diseases and Nutrition Research; 93.849, Kidney Diseases, Urology
and Hematology Research, National Institutes of Health, HHS)
Dated: January 30, 2019.
Melanie J. Pantoja,
Program Analyst, Office of Federal Advisory Committee Policy.
[FR Doc. 2019-01086 Filed 2-4-19; 8:45 am]
BILLING CODE 4140-01-P
