National Cancer Institute; Amended Notice of Meeting, 1765-1766 [2019-01010]
Download as PDF
<![CDATA[
Federal Register / Vol. 84, No. 24 / Tuesday, February 5, 2019 / Notices
2006, now abandoned (HHS Ref. No. E–
227–2006/1–US–01);
3. U.S. Provisional Patent Application
No. 60/888,754, filed February 07, 2007,
now abandoned (HHS Ref. No. E–227–
2006/2–US–01);
4. U.S. Provisional Patent Application
No. 60/910,549, filed April 06, 2007,
now abandoned (HHS Ref. No. E–227–
2006/3–US–01);
5. U.S. Provisional Patent Application
No. 60/956,375, filed August 16, 2007,
now abandoned (HHS Ref. No. E–227–
2006/4–US–01);
6. PCT Patent Application No. PCT/
2007/080647, filed October 5, 2007, now
abandoned (HHS Ref. No. E–227–2006/
5–PCT–01);
7. U.S. Patent No. 8,236,313, filed
April 3, 2009, Issued August 7, 2012
(HHS Ref. No. E–227–2006/5–US–02);
8. Canadian Patent Application No.
2,665,287, October 5, 2007 (HHS Ref.
No. E–227–2006/5–CA–03);
9. Australian Patent No. 2007319576,
filed October 5, 2007, Issued May 1,
2014 (HHS Ref. No. E–227–2006/5–AU–
04);
10. European Patent Application No.
07868382.8, filed March 27, 2009 (HHS
Ref. No. E–227–2006/5–EP–05);
11. U.S. Patent Application No. 13/
546,931, filed July 11, 2012 (HHS Ref.
No. E–227–2006/5–US–06);
12. U.S. Patent Number 8,557,788,
filed July 11, 2012, Issued October 15,
2013 (HHS Ref. No. E–227–2006/5–US–
07);
13. European Patent Application No.
13180563.2, filed October 5, 2007 (HHS
Ref. No. E–227–2006/5–EP–08);
14. Australian Patent No. 2014201936,
filed October 5, 2007, Issued October 20,
2016 (HHS Ref. No. E–227–2006/5–AU–
09);
15. U.S. Patent Application No. 14/
500,861, filed September 29, 2014 (HHS
Ref. No. E–227–2006/5–US–10);
16. Australian Patent No. 2016238894,
filed October 6, 2016, Issued February
22, 2018 (HHS Ref. No. E–227–2006/5–
AU–11); and
17. Australian Patent Application No.
2018200921, filed February 8, 2018
(HHS Ref. No. E–227–2006/5–AU–12).
The patent rights in these inventions
have been assigned and/or exclusively
licensed to the government of the
United States of America.
The prospective exclusive license
territory may be worldwide, and the
field of use may be limited to: ‘‘The use
of the CD47 phosphorodiamidate
morpholino oligomers (PMO,
morpholino, Sequence: 5′CGTCACAGGCAGGACCCACTGCCCA3′) for the treatment, prevention, and
diagnosis of solid tumors, excluding
uses in combination with radiotherapy.’’
VerDate Sep<11>2014
17:22 Feb 04, 2019
Jkt 247001
This technology concerns CD47,
originally named integrin-associated
protein, which is a receptor for
thrombospondin-1 (TSP1), a major
component of platelet a-granules from
which it is secreted on platelet
activation. A number of important roles
for CD47 have been defined in
regulating the migration, proliferation,
and survival of vascular cells, and in
regulation of innate and adaptive
immunity. Nitric Oxide (NO) plays an
important role as a major intrinsic
vasodilator, and it increases blood flow
to tissues and organs. Disruption of this
process leads to peripheral vascular
disease, ischemic heart disease, stroke,
diabetes and many more significant
diseases. The inventors have discovered
that TSP1 blocks the beneficial effects of
NO and prevents it from dilating blood
vessels and increasing blood flow to
organs and tissues. Additionally, they
discovered that this regulation requires
TSP1 interaction with its cell receptor,
CD47. These inventors have also found
that blocking TSP1-CD47 interaction
through the use of antisense morpholino
oligonucleotides, peptides or antibodies
have several therapeutic benefits
including the treatment of cancer.
This notice is made in accordance
with 35 U.S.C. 209 and 37 CFR part 404.
The prospective exclusive license will
be royalty bearing, and the prospective
exclusive license may be granted unless
within fifteen (15) days from the date of
this published notice, the National
Cancer Institute receives written
evidence and argument that establishes
that the grant of the license would not
be consistent with the requirements of
35 U.S.C. 209 and 37 CFR part 404.
In response to this Notice, the public
may file comments or objections.
Comments and objections, other than
those in the form of a license
application, will not be treated
confidentially, and may be made
publicly available.
License applications submitted in
response to this Notice will be
presumed to contain business
confidential information and any release
of information in these license
applications will be made only as
required and upon a request under the
Freedom of Information Act, 5 U.S.C.
552.
Dated: December 18, 2018.
Richard U. Rodriguez,
Associate Director, Technology Transfer
Center, National Cancer Institute.
[FR Doc. 2019–00909 Filed 2–4–19; 8:45 am]
BILLING CODE 4140–01–P
PO 00000
Frm 00068
Fmt 4703
Sfmt 4703
1765
DEPARTMENT OF HEALTH AND
HUMAN SERVICES
National Institutes of Health
National Institute of Diabetes and
Digestive and Kidney Diseases; Notice
of Closed Meeting
Pursuant to section 10(d) of the
Federal Advisory Committee Act, as
amended, notice is hereby given of a
meeting of the Board of Scientific
Counselors, NIDDK.
The meeting will be closed to the
public as indicated below in accordance
with the provisions set forth in section
552b(c)(6), Title 5 U.S.C., as amended
for the review, discussion, and
evaluation of individual intramural
programs and projects conducted by the
National Institute of Diabetes and
Digestive and Kidney Diseases,
including consideration of personnel
qualifications and performance, and the
competence of individual investigators,
the disclosure of which would
constitute a clearly unwarranted
invasion of personal privacy.
Name of Committee: Board of Scientific
Counselors, NIDDK.
Date: October 10–11, 2019.
Time: 8:00 a.m. to 6:00 p.m.
Agenda: To review and evaluate personal
qualifications and performance, and
competence of individual investigators.
Place: National Institutes of Health,
Building 10, Solarium Conference Room
9S233, 10 Center Drive, Bethesda, MD 20892.
Contact Person: Michael W. Krause, Ph.D.,
Scientific Director, National Institute of
Diabetes and Digestive and Kidney Diseases,
National Institute of Health, Building 5,
Room B104, Bethesda, MD 20892–1818, (301)
402–4633, mwkrause@helix.nih.gov.
(Catalogue of Federal Domestic Assistance
Program Nos. 93.847, Diabetes,
Endocrinology and Metabolic Research;
93.848, Digestive Diseases and Nutrition
Research; 93.849, Kidney Diseases, Urology
and Hematology Research, National Institutes
of Health, HHS)
Dated: January 30, 2019.
Melanie J. Pantoja,
Program Analyst, Office of Federal Advisory
Committee Policy.
[FR Doc. 2019–01086 Filed 2–4–19; 8:45 am]
BILLING CODE 4140–01–P
DEPARTMENT OF HEALTH AND
HUMAN SERVICES
National Institutes of Health
National Cancer Institute; Amended
Notice of Meeting
Notice is hereby given of a change in
the meeting of the National Cancer
Institute Special Emphasis Panel,
E:\FR\FM\05FEN1.SGM
05FEN1
1766
Federal Register / Vol. 84, No. 24 / Tuesday, February 5, 2019 / Notices
February 14, 2019, 04:00 p.m. to
February 15, 2019, 02:30 p.m.,
Gaithersburg Marriott Washingtonian
Center, 9751 Washingtonian Boulevard,
Gaithersburg, MD, 20878 which was
published in the Federal Register on
November 27, 2018, 83 FR 60880.
This meeting notice is amended to
reschedule the meeting to April 9, 2019
from 8:00 a.m. to 4:00 p.m. The meeting
is closed to the public.
Dated: January 30, 2019.
Melanie J. Pantoja,
Program Analyst, Office of Federal Advisory
Committee Policy.
[FR Doc. 2019–01010 Filed 2–4–19; 8:45 am]
BILLING CODE 4140–01–P
DEPARTMENT OF HEALTH AND
HUMAN SERVICES
National Institutes of Health
National Cancer Institute; Notice of
Closed Meeting
Pursuant to section 10(d) of the
Federal Advisory Committee Act, as
amended, notice is hereby given of the
following meeting.
The meeting will be closed to the
public in accordance with the
provisions set forth in sections
552b(c)(4) and 552b(c)(6), Title 5 U.S.C.,
as amended. The grant applications and
the discussions could disclose
confidential trade secrets or commercial
property such as patentable material,
and personal information concerning
individuals associated with grant
applications, the disclosure of which
would constitute a clearly unwarranted
invasion of personal privacy.
Name of Committee: National Cancer
Institute Special Emphasis Panel; SEP–5 for
Provocative Questions.
Date: March 6, 2019.
Time: 7:45 a.m. to 4:30 p.m.
Agenda: To review and evaluate grant
applications.
Place: Gaithersburg Marriott
Washingtonian Center, 9751 Washingtonian
Boulevard Gaithersburg, MD 20878.
Contact Person: Byeong-Chel Lee, Ph.D.
Scientific Review Officer Resources and
Training Review Branch Division of
Extramural Activities National Cancer
Institute, NIH 9609 Medical Center Drive,
Room 7W238 Bethesda, MD 20892–9750
240–276–7755 byeong-chel.lee@nih.gov.
(Catalogue of Federal Domestic Assistance
Program Nos. 93.392, Cancer Construction;
93.393, Cancer Cause and Prevention
Research; 93.394, Cancer Detection and
Diagnosis Research; 93.395, Cancer
Treatment Research; 93.396, Cancer Biology
Research; 93.397, Cancer Centers Support;
93.398, Cancer Research Manpower; 93.399,
Cancer Control, National Institutes of Health,
HHS)
VerDate Sep<11>2014
17:22 Feb 04, 2019
Jkt 247001
Dated: January 30, 2019.
Melanie J. Pantoja,
Program Analyst, Office of Federal Advisory
Committee Policy.
[FR Doc. 2019–01081 Filed 2–4–19; 8:45 am]
BILLING CODE 4140–01–P
DEPARTMENT OF HEALTH AND
HUMAN SERVICES
National Institutes of Health
Center for Scientific Review; Notice of
Closed Meetings
Pursuant to section 10(d) of the
Federal Advisory Committee Act, as
amended, notice is hereby given of the
following meetings.
The meetings will be closed to the
public in accordance with the
provisions set forth in sections
552b(c)(4) and 552b(c)(6), Title 5 U.S.C.,
as amended. The grant applications and
the discussions could disclose
confidential trade secrets or commercial
property such as patentable material,
and personal information concerning
individuals associated with the grant
applications, the disclosure of which
would constitute a clearly unwarranted
invasion of personal privacy.
Name of Committee: Infectious Diseases
and Microbiology Integrated Review Group;
Virology—A Study Section.
Date: February 28–March 1, 2019.
Time: 8:00 a.m. to 5:00 p.m.
Agenda: To review and evaluate grant
applications.
Place: Holiday Inn Bayside, 4875 North
Harbor Drive, San Diego, CA 92106.
Contact Person: Kenneth M Izumi, Ph.D.,
Scientific Review Officer, Center for
Scientific Review, National Institutes of
Health, 6701 Rockledge Drive, Room
3204,MSC 7808, Bethesda, MD 20892, 301–
496–6980, izumikm@csr.nih.gov.
Name of Committee: Center for Scientific
Review Special Emphasis Panel; Program
Projects: Drug Abuse.
Date: March 1, 2019.
Time: 11:00 a.m. to 5:00 p.m.
Agenda: To review and evaluate grant
applications.
Place: St. Gregory Hotel, 2033 M Street
NW, Washington, DC 20036.
Contact Person: Jasenka Borzan, Ph.D.,
Scientific Review Officer, Center for
Scientific Review, National Institutes of
Health, 6701 Rockledge Drive Room 4214
MSC 7814, Bethesda, MD 20892–7814, 301–
435–1787, borzanj@csr.nih.gov.
Name of Committee: Center for Scientific
Review Special Emphasis Panel; PAR
Review: Prediction, Communication, and
Intervention for Cancer Patients, Caregivers,
and Communities.
Date: March 1, 2019.
Time: 11:00 a.m. to 6:00 p.m.
Agenda: To review and evaluate grant
applications.
PO 00000
Frm 00069
Fmt 4703
Sfmt 4703
Place: National Institutes of Health, 6701
Rockledge Drive, Bethesda, MD 20892
(Virtual Meeting).
Contact Person: John H. Newman, Ph.D.,
Scientific Review Officer, Center for
Scientific Review, National Institutes of
Health, 6701 Rockledge Drive, Room 3222,
MSC 7808, Bethesda, MD 20892, (301) 435–
0628, newmanjh@csr.nih.gov.
Name of Committee: Center for Scientific
Review Special Emphasis Panel; Accelerating
the Pace of Drug Abuse Research Using
Existing Data.
Date: March 1, 2019.
Time: 11:00 a.m. to 4:00 p.m.
Agenda: To review and evaluate grant
applications.
Place: National Institutes of Health, 6701
Rockledge Drive, Bethesda, MD 20892
(Virtual Meeting).
Contact Person: Kate Fothergill, Ph.D.,
Scientific Review Officer, Center for
Scientific Review, National Institutes of
Health, 6701 Rockledge Drive Room 3142,
Bethesda, MD 20892, 301–435–2309,
fothergillke@mail.nih.gov.
Name of Committee: Center for Scientific
Review Special Emphasis Panel; Member
Conflict: Healthcare Delivery and
Methodologies.
Date: March 1, 2019.
Time: 11:00 a.m. to 4:00 p.m.
Agenda: To review and evaluate grant
applications.
Place: National Institutes of Health, 6701
Rockledge Drive, Bethesda, MD 20892
(Telephone Conference Call).
Contact Person: Ping Wu, Ph.D., Scientific
Review Officer, HDM IRG, Center for
Scientific Review, National Institutes of
Health, 6701 Rockledge Drive, Room 3166,
Bethesda, MD 20892, 301–451–8428, wup4@
csr.nih.gov.
Name of Committee: Center for Scientific
Review Special Emphasis Panel;
Neurobiology and Neuropathogenesis of
Neurodegerative Diseases.
Date: March 1, 2019.
Time: 11:00 a.m. to 3:00 p.m.
Agenda: To review and evaluate grant
applications.
Place: National Institutes of Health, 6701
Rockledge Drive, Bethesda, MD 20892
(Virtual Meeting).
Contact Person: Wei-Qin Zhao, Ph.D.,
Scientific Review Officer, Center for
Scientific Review, National Institutes of
Health, 6701 Rockledge Drive, Room 5181,
MSC 7846, Bethesda, MD 20892–7846, 301–
827–7238, zhaow@csr.nih.gov.
Name of Committee: Center for Scientific
Review Special Emphasis Panel; African
Health Professional Education Partnership
Initiative.
Date: March 1, 2019.
Time: 1:00 p.m. to 5:00 p.m.
Agenda: To review and evaluate grant
applications.
Place: National Institutes of Health, 6701
Rockledge Drive, Bethesda, MD 20892
(Telephone Conference Call).
Contact Person: Shalanda A. Bynum,
Ph.D., Scientific Review Officer, Center for
Scientific Review, National Institutes of
Health, 6701 Rockledge Drive, Room 3206,
E:\FR\FM\05FEN1.SGM
05FEN1
]]>Agencies
[Federal Register Volume 84, Number 24 (Tuesday, February 5, 2019)]
[Notices]
[Pages 1765-1766]
From the Federal Register Online via the Government Publishing Office [www.gpo.gov]
[FR Doc No: 2019-01010]
-----------------------------------------------------------------------
DEPARTMENT OF HEALTH AND HUMAN SERVICES
National Institutes of Health
National Cancer Institute; Amended Notice of Meeting
Notice is hereby given of a change in the meeting of the National
Cancer Institute Special Emphasis Panel,
[[Page 1766]]
February 14, 2019, 04:00 p.m. to February 15, 2019, 02:30 p.m.,
Gaithersburg Marriott Washingtonian Center, 9751 Washingtonian
Boulevard, Gaithersburg, MD, 20878 which was published in the Federal
Register on November 27, 2018, 83 FR 60880.
This meeting notice is amended to reschedule the meeting to April
9, 2019 from 8:00 a.m. to 4:00 p.m. The meeting is closed to the
public.
Dated: January 30, 2019.
Melanie J. Pantoja,
Program Analyst, Office of Federal Advisory Committee Policy.
[FR Doc. 2019-01010 Filed 2-4-19; 8:45 am]
BILLING CODE 4140-01-P
