Prospective Grant of an Exclusive Patent License: Use of the CD47 Phosphorodiamidate Morpholino Oligomers for the Treatment, Prevention, and Diagnosis of Solid Tumors, 1764-1765 [2019-00909]
Download as PDF
<![CDATA[
1764
Federal Register / Vol. 84, No. 24 / Tuesday, February 5, 2019 / Notices
DEPARTMENT OF HEALTH AND
HUMAN SERVICES
DEPARTMENT OF HEALTH AND
HUMAN SERVICES
DEPARTMENT OF HEALTH AND
HUMAN SERVICES
National Institutes of Health
National Institutes of Health
National Institutes of Health
National Institute of General Medical
Sciences; Notice of Closed Meeting
National Institute of Diabetes and
Digestive and Kidney Diseases; Notice
of Closed Meeting
Prospective Grant of an Exclusive
Patent License: Use of the CD47
Phosphorodiamidate Morpholino
Oligomers for the Treatment,
Prevention, and Diagnosis of Solid
Tumors
Pursuant to section 10(d) of the
Federal Advisory Committee Act, as
amended, notice is hereby given of the
following meeting.
The meeting will be closed to the
public in accordance with the
provisions set forth in sections
552b(c)(4) and 552b(c)(6), Title 5 U.S.C.,
as amended. The grant applications and
the discussions could disclose
confidential trade secrets or commercial
property such as patentable material,
and personal information concerning
individuals associated with the grant
applications, the disclosure of which
would constitute a clearly unwarranted
invasion of personal privacy.
Name of Committee: National Institute of
General Medical Sciences Special Emphasis
Panel; Review of PRAT Fellowship
Applications.
Date: February 28, 2019.
Time: 8:00 a.m. to 5:00 p.m.
Agenda: To review and evaluate grant
applications.
Place: Embassy Suites at Chevy Chase
Pavilion, 4300 Military Road NW,
Washington, DC 20015.
Contact Person: John J. Laffan, Scientific
Review Officer, Office of Scientific Review,
National Institute of General Medical
Sciences, National Institutes of Health,
Natcher Building, Room 3AN18J, Bethesda,
MD 20892, 301–594–2773, laffanjo@
mail.nih.gov.
(Catalogue of Federal Domestic Assistance
Program Nos. 93.375, Minority Biomedical
Research Support; 93.821, Cell Biology and
Biophysics Research; 93.859, Pharmacology,
Physiology, and Biological Chemistry
Research; 93.862, Genetics and
Developmental Biology Research; 93.88,
Minority Access to Research Careers; 93.96,
Special Minority Initiatives; 93.859,
Biomedical Research and Research Training,
National Institutes of Health, HHS)
Dated: January 30, 2019.
Melanie J. Pantoja,
Program Analyst, Office of Federal Advisory
Committee Policy.
Pursuant to section 10(d) of the
Federal Advisory Committee Act, as
amended, notice is hereby given of the
following meeting.
The meeting will be closed to the
public in accordance with the
provisions set forth in sections
552b(c)(4) and 552b(c)(6), Title 5 U.S.C.,
as amended. The grant applications and
the discussions could disclose
confidential trade secrets or commercial
property such as patentable material,
and personal information concerning
individuals associated with the grant
applications, the disclosure of which
would constitute a clearly unwarranted
invasion of personal privacy.
Name of Committee: National Institute of
Diabetes and Digestive and Kidney Diseases
Special Emphasis Panel, P01 Program Project
Review—NuBeta.
Date: February 27, 2019.
Time: 11:30 a.m. to 3:30 p.m.
Agenda: To review and evaluate grant
applications.
Place: National Institutes of Health, Two
Democracy Plaza, 6707 Democracy
Boulevard, Bethesda, MD 20892, (Telephone
Conference Call).
Contact Person: Charlene J. Repique, Ph.D.,
Scientific Review Officer, Review Branch,
DEA, NIDDK, National Institutes of Health,
Room 7347, 6707 Democracy Boulevard,
Bethesda, MD 20892–5452, (301) 451–3638,
charlene.repique@nih.gov.
(Catalogue of Federal Domestic Assistance
Program Nos. 93.847, Diabetes,
Endocrinology and Metabolic Research;
93.848, Digestive Diseases and Nutrition
Research; 93.849, Kidney Diseases, Urology
and Hematology Research, National Institutes
of Health, HHS)
Dated: January 30, 2019.
Melanie J. Pantoja,
Program Analyst, Office of Federal Advisory
Committee Policy.
[FR Doc. 2019–01083 Filed 2–4–19; 8:45 am]
BILLING CODE 4140–01–P
[FR Doc. 2019–01091 Filed 2–4–19; 8:45 am]
AGENCY:
National Institutes of Health,
HHS.
ACTION:
Notice.
The National Cancer Institute,
an institute of the National Institutes of
Health, Department of Health and
Human Services, is contemplating the
grant of an Exclusive Patent License to
practice the inventions embodied in the
Patents and Patent Applications listed
in the Supplementary Information
section of this notice to Morphiex
Biotherapeutics (‘‘Morphiex’’) located in
Boston, MA.
DATES: Only written comments and/or
applications for a license which are
received by the National Cancer
Institute’s Technology Transfer Center
on or before February 20, 2019 will be
considered.
ADDRESSES: Requests for copies of the
patent application, inquiries, and
comments relating to the contemplated
an Exclusive Patent License should be
directed to: Jaime Greene, Senior
Licensing and Patenting Manager, NCI
Technology Transfer Center, 9609
Medical Center Drive, RM 1E530 MSC
9702, Bethesda, MD 20892–9702 (for
business mail), Rockville, MD 20850–
9702 Telephone: (240)–276–5530;
Facsimile: (240)–276–5504 Email:
greenejaime@mail.nih.gov.
SUPPLEMENTARY INFORMATION: This is in
reference to a previous notice 83 FR
22501, which was a Prospective Grant of
an Exclusive Patent License to
Morphiex for the field of use ‘‘the use
of the CD47 phosphorodiamidate
morpholino oligomers (PMO,
morpholino, Sequence: 5′CGTCACAGGCAGGACCCACTGCCCA3′) for the treatment, prevention, and
diagnosis of hematological cancers (e.g.
lymphoma, leukemia, multiple
myeloma), excluding uses in
combination with radiotherapy.’’
SUMMARY:
Intellectual Property
BILLING CODE 4140–01–P
1. U.S. Provisional Patent Application
No. 60/850,132, filed October 6, 2006,
now abandoned (HHS Ref. No. E–227–
2006/0–US–01);
2. U.S. Provisional Patent Application
No. 60/864,153, filed November 02,
VerDate Sep<11>2014
17:22 Feb 04, 2019
Jkt 247001
PO 00000
Frm 00067
Fmt 4703
Sfmt 4703
E:\FR\FM\05FEN1.SGM
05FEN1
Federal Register / Vol. 84, No. 24 / Tuesday, February 5, 2019 / Notices
2006, now abandoned (HHS Ref. No. E–
227–2006/1–US–01);
3. U.S. Provisional Patent Application
No. 60/888,754, filed February 07, 2007,
now abandoned (HHS Ref. No. E–227–
2006/2–US–01);
4. U.S. Provisional Patent Application
No. 60/910,549, filed April 06, 2007,
now abandoned (HHS Ref. No. E–227–
2006/3–US–01);
5. U.S. Provisional Patent Application
No. 60/956,375, filed August 16, 2007,
now abandoned (HHS Ref. No. E–227–
2006/4–US–01);
6. PCT Patent Application No. PCT/
2007/080647, filed October 5, 2007, now
abandoned (HHS Ref. No. E–227–2006/
5–PCT–01);
7. U.S. Patent No. 8,236,313, filed
April 3, 2009, Issued August 7, 2012
(HHS Ref. No. E–227–2006/5–US–02);
8. Canadian Patent Application No.
2,665,287, October 5, 2007 (HHS Ref.
No. E–227–2006/5–CA–03);
9. Australian Patent No. 2007319576,
filed October 5, 2007, Issued May 1,
2014 (HHS Ref. No. E–227–2006/5–AU–
04);
10. European Patent Application No.
07868382.8, filed March 27, 2009 (HHS
Ref. No. E–227–2006/5–EP–05);
11. U.S. Patent Application No. 13/
546,931, filed July 11, 2012 (HHS Ref.
No. E–227–2006/5–US–06);
12. U.S. Patent Number 8,557,788,
filed July 11, 2012, Issued October 15,
2013 (HHS Ref. No. E–227–2006/5–US–
07);
13. European Patent Application No.
13180563.2, filed October 5, 2007 (HHS
Ref. No. E–227–2006/5–EP–08);
14. Australian Patent No. 2014201936,
filed October 5, 2007, Issued October 20,
2016 (HHS Ref. No. E–227–2006/5–AU–
09);
15. U.S. Patent Application No. 14/
500,861, filed September 29, 2014 (HHS
Ref. No. E–227–2006/5–US–10);
16. Australian Patent No. 2016238894,
filed October 6, 2016, Issued February
22, 2018 (HHS Ref. No. E–227–2006/5–
AU–11); and
17. Australian Patent Application No.
2018200921, filed February 8, 2018
(HHS Ref. No. E–227–2006/5–AU–12).
The patent rights in these inventions
have been assigned and/or exclusively
licensed to the government of the
United States of America.
The prospective exclusive license
territory may be worldwide, and the
field of use may be limited to: ‘‘The use
of the CD47 phosphorodiamidate
morpholino oligomers (PMO,
morpholino, Sequence: 5′CGTCACAGGCAGGACCCACTGCCCA3′) for the treatment, prevention, and
diagnosis of solid tumors, excluding
uses in combination with radiotherapy.’’
VerDate Sep<11>2014
17:22 Feb 04, 2019
Jkt 247001
This technology concerns CD47,
originally named integrin-associated
protein, which is a receptor for
thrombospondin-1 (TSP1), a major
component of platelet a-granules from
which it is secreted on platelet
activation. A number of important roles
for CD47 have been defined in
regulating the migration, proliferation,
and survival of vascular cells, and in
regulation of innate and adaptive
immunity. Nitric Oxide (NO) plays an
important role as a major intrinsic
vasodilator, and it increases blood flow
to tissues and organs. Disruption of this
process leads to peripheral vascular
disease, ischemic heart disease, stroke,
diabetes and many more significant
diseases. The inventors have discovered
that TSP1 blocks the beneficial effects of
NO and prevents it from dilating blood
vessels and increasing blood flow to
organs and tissues. Additionally, they
discovered that this regulation requires
TSP1 interaction with its cell receptor,
CD47. These inventors have also found
that blocking TSP1-CD47 interaction
through the use of antisense morpholino
oligonucleotides, peptides or antibodies
have several therapeutic benefits
including the treatment of cancer.
This notice is made in accordance
with 35 U.S.C. 209 and 37 CFR part 404.
The prospective exclusive license will
be royalty bearing, and the prospective
exclusive license may be granted unless
within fifteen (15) days from the date of
this published notice, the National
Cancer Institute receives written
evidence and argument that establishes
that the grant of the license would not
be consistent with the requirements of
35 U.S.C. 209 and 37 CFR part 404.
In response to this Notice, the public
may file comments or objections.
Comments and objections, other than
those in the form of a license
application, will not be treated
confidentially, and may be made
publicly available.
License applications submitted in
response to this Notice will be
presumed to contain business
confidential information and any release
of information in these license
applications will be made only as
required and upon a request under the
Freedom of Information Act, 5 U.S.C.
552.
Dated: December 18, 2018.
Richard U. Rodriguez,
Associate Director, Technology Transfer
Center, National Cancer Institute.
[FR Doc. 2019–00909 Filed 2–4–19; 8:45 am]
BILLING CODE 4140–01–P
PO 00000
Frm 00068
Fmt 4703
Sfmt 4703
1765
DEPARTMENT OF HEALTH AND
HUMAN SERVICES
National Institutes of Health
National Institute of Diabetes and
Digestive and Kidney Diseases; Notice
of Closed Meeting
Pursuant to section 10(d) of the
Federal Advisory Committee Act, as
amended, notice is hereby given of a
meeting of the Board of Scientific
Counselors, NIDDK.
The meeting will be closed to the
public as indicated below in accordance
with the provisions set forth in section
552b(c)(6), Title 5 U.S.C., as amended
for the review, discussion, and
evaluation of individual intramural
programs and projects conducted by the
National Institute of Diabetes and
Digestive and Kidney Diseases,
including consideration of personnel
qualifications and performance, and the
competence of individual investigators,
the disclosure of which would
constitute a clearly unwarranted
invasion of personal privacy.
Name of Committee: Board of Scientific
Counselors, NIDDK.
Date: October 10–11, 2019.
Time: 8:00 a.m. to 6:00 p.m.
Agenda: To review and evaluate personal
qualifications and performance, and
competence of individual investigators.
Place: National Institutes of Health,
Building 10, Solarium Conference Room
9S233, 10 Center Drive, Bethesda, MD 20892.
Contact Person: Michael W. Krause, Ph.D.,
Scientific Director, National Institute of
Diabetes and Digestive and Kidney Diseases,
National Institute of Health, Building 5,
Room B104, Bethesda, MD 20892–1818, (301)
402–4633, mwkrause@helix.nih.gov.
(Catalogue of Federal Domestic Assistance
Program Nos. 93.847, Diabetes,
Endocrinology and Metabolic Research;
93.848, Digestive Diseases and Nutrition
Research; 93.849, Kidney Diseases, Urology
and Hematology Research, National Institutes
of Health, HHS)
Dated: January 30, 2019.
Melanie J. Pantoja,
Program Analyst, Office of Federal Advisory
Committee Policy.
[FR Doc. 2019–01086 Filed 2–4–19; 8:45 am]
BILLING CODE 4140–01–P
DEPARTMENT OF HEALTH AND
HUMAN SERVICES
National Institutes of Health
National Cancer Institute; Amended
Notice of Meeting
Notice is hereby given of a change in
the meeting of the National Cancer
Institute Special Emphasis Panel,
E:\FR\FM\05FEN1.SGM
05FEN1
]]>Agencies
[Federal Register Volume 84, Number 24 (Tuesday, February 5, 2019)]
[Notices]
[Pages 1764-1765]
From the Federal Register Online via the Government Publishing Office [www.gpo.gov]
[FR Doc No: 2019-00909]
-----------------------------------------------------------------------
DEPARTMENT OF HEALTH AND HUMAN SERVICES
National Institutes of Health
Prospective Grant of an Exclusive Patent License: Use of the CD47
Phosphorodiamidate Morpholino Oligomers for the Treatment, Prevention,
and Diagnosis of Solid Tumors
AGENCY: National Institutes of Health, HHS.
ACTION: Notice.
-----------------------------------------------------------------------
SUMMARY: The National Cancer Institute, an institute of the National
Institutes of Health, Department of Health and Human Services, is
contemplating the grant of an Exclusive Patent License to practice the
inventions embodied in the Patents and Patent Applications listed in
the Supplementary Information section of this notice to Morphiex
Biotherapeutics (``Morphiex'') located in Boston, MA.
DATES: Only written comments and/or applications for a license which
are received by the National Cancer Institute's Technology Transfer
Center on or before February 20, 2019 will be considered.
ADDRESSES: Requests for copies of the patent application, inquiries,
and comments relating to the contemplated an Exclusive Patent License
should be directed to: Jaime Greene, Senior Licensing and Patenting
Manager, NCI Technology Transfer Center, 9609 Medical Center Drive, RM
1E530 MSC 9702, Bethesda, MD 20892-9702 (for business mail), Rockville,
MD 20850-9702 Telephone: (240)-276-5530; Facsimile: (240)-276-5504
Email: greenejaime@mail.nih.gov.
SUPPLEMENTARY INFORMATION: This is in reference to a previous notice 83
FR 22501, which was a Prospective Grant of an Exclusive Patent License
to Morphiex for the field of use ``the use of the CD47
phosphorodiamidate morpholino oligomers (PMO, morpholino, Sequence: 5'-
CGTCACAGGCAGGACCCACTGCCCA-3') for the treatment, prevention, and
diagnosis of hematological cancers (e.g. lymphoma, leukemia, multiple
myeloma), excluding uses in combination with radiotherapy.''
Intellectual Property
1. U.S. Provisional Patent Application No. 60/850,132, filed
October 6, 2006, now abandoned (HHS Ref. No. E-227-2006/0-US-01);
2. U.S. Provisional Patent Application No. 60/864,153, filed
November 02,
[[Page 1765]]
2006, now abandoned (HHS Ref. No. E-227-2006/1-US-01);
3. U.S. Provisional Patent Application No. 60/888,754, filed
February 07, 2007, now abandoned (HHS Ref. No. E-227-2006/2-US-01);
4. U.S. Provisional Patent Application No. 60/910,549, filed April
06, 2007, now abandoned (HHS Ref. No. E-227-2006/3-US-01);
5. U.S. Provisional Patent Application No. 60/956,375, filed August
16, 2007, now abandoned (HHS Ref. No. E-227-2006/4-US-01);
6. PCT Patent Application No. PCT/2007/080647, filed October 5,
2007, now abandoned (HHS Ref. No. E-227-2006/5-PCT-01);
7. U.S. Patent No. 8,236,313, filed April 3, 2009, Issued August 7,
2012 (HHS Ref. No. E-227-2006/5-US-02);
8. Canadian Patent Application No. 2,665,287, October 5, 2007 (HHS
Ref. No. E-227-2006/5-CA-03);
9. Australian Patent No. 2007319576, filed October 5, 2007, Issued
May 1, 2014 (HHS Ref. No. E-227-2006/5-AU-04);
10. European Patent Application No. 07868382.8, filed March 27,
2009 (HHS Ref. No. E-227-2006/5-EP-05);
11. U.S. Patent Application No. 13/546,931, filed July 11, 2012
(HHS Ref. No. E-227-2006/5-US-06);
12. U.S. Patent Number 8,557,788, filed July 11, 2012, Issued
October 15, 2013 (HHS Ref. No. E-227-2006/5-US-07);
13. European Patent Application No. 13180563.2, filed October 5,
2007 (HHS Ref. No. E-227-2006/5-EP-08);
14. Australian Patent No. 2014201936, filed October 5, 2007, Issued
October 20, 2016 (HHS Ref. No. E-227-2006/5-AU-09);
15. U.S. Patent Application No. 14/500,861, filed September 29,
2014 (HHS Ref. No. E-227-2006/5-US-10);
16. Australian Patent No. 2016238894, filed October 6, 2016, Issued
February 22, 2018 (HHS Ref. No. E-227-2006/5-AU-11); and
17. Australian Patent Application No. 2018200921, filed February 8,
2018 (HHS Ref. No. E-227-2006/5-AU-12).
The patent rights in these inventions have been assigned and/or
exclusively licensed to the government of the United States of America.
The prospective exclusive license territory may be worldwide, and
the field of use may be limited to: ``The use of the CD47
phosphorodiamidate morpholino oligomers (PMO, morpholino, Sequence: 5'-
CGTCACAGGCAGGACCCACTGCCCA-3') for the treatment, prevention, and
diagnosis of solid tumors, excluding uses in combination with
radiotherapy.''
This technology concerns CD47, originally named integrin-associated
protein, which is a receptor for thrombospondin-1 (TSP1), a major
component of platelet [alpha]-granules from which it is secreted on
platelet activation. A number of important roles for CD47 have been
defined in regulating the migration, proliferation, and survival of
vascular cells, and in regulation of innate and adaptive immunity.
Nitric Oxide (NO) plays an important role as a major intrinsic
vasodilator, and it increases blood flow to tissues and organs.
Disruption of this process leads to peripheral vascular disease,
ischemic heart disease, stroke, diabetes and many more significant
diseases. The inventors have discovered that TSP1 blocks the beneficial
effects of NO and prevents it from dilating blood vessels and
increasing blood flow to organs and tissues. Additionally, they
discovered that this regulation requires TSP1 interaction with its cell
receptor, CD47. These inventors have also found that blocking TSP1-CD47
interaction through the use of antisense morpholino oligonucleotides,
peptides or antibodies have several therapeutic benefits including the
treatment of cancer.
This notice is made in accordance with 35 U.S.C. 209 and 37 CFR
part 404. The prospective exclusive license will be royalty bearing,
and the prospective exclusive license may be granted unless within
fifteen (15) days from the date of this published notice, the National
Cancer Institute receives written evidence and argument that
establishes that the grant of the license would not be consistent with
the requirements of 35 U.S.C. 209 and 37 CFR part 404.
In response to this Notice, the public may file comments or
objections. Comments and objections, other than those in the form of a
license application, will not be treated confidentially, and may be
made publicly available.
License applications submitted in response to this Notice will be
presumed to contain business confidential information and any release
of information in these license applications will be made only as
required and upon a request under the Freedom of Information Act, 5
U.S.C. 552.
Dated: December 18, 2018.
Richard U. Rodriguez,
Associate Director, Technology Transfer Center, National Cancer
Institute.
[FR Doc. 2019-00909 Filed 2-4-19; 8:45 am]
BILLING CODE 4140-01-P
