National Institute of General Medical Sciences; Notice of Closed Meeting, 22501-22502 [2018-10356]

Download as PDF Federal Register / Vol. 83, No. 94 / Tuesday, May 15, 2018 / Notices DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health Prospective Grant of an Exclusive Patent License: Use of the CD47 Phosphorodiamidate Morpholino Oligomers for the Treatment, Prevention, and Diagnosis of Hematological Cancers AGENCY: National Institutes of Health, HHS. ACTION: Notice. The National Cancer Institute, an institute of the National Institutes of Health, Department of Health and Human Services, is contemplating the grant of an Exclusive Patent License to practice the inventions embodied in the Patents and Patent Applications listed in the Supplementary Information section of this notice to Morphiex Biotherapeutics (‘‘Morphiex’’) located in Boston, MA. DATES: Only written comments and/or applications for a license which are received by the National Cancer Institute’s Technology Transfer Center on or before May 30, 2018 will be considered. ADDRESSES: Requests for copies of the patent application, inquiries, and comments relating to the contemplated an Exclusive Patent License should be directed to: Jaime M. Greene, Senior Licensing and Patenting Manager, NCI Technology Transfer Center, 9609 Medical Center Drive, RM 1E530 MSC 9702, Bethesda, MD 20892–9702 (for business mail), Rockville, MD 20850– 9702 Telephone: (240) 276–5530; Facsimile: (240)–276–5504 Email: greenejaime@mail.nih.gov. SUPPLEMENTARY INFORMATION: daltland on DSKBBV9HB2PROD with NOTICES SUMMARY: Intellectual Property 1. U.S. Provisional Patent Application No. 60/850,132, filed October 6, 2006, now abandoned (HHS Ref. No. E–227– 2006/0–US–01); 2. U.S. Provisional Patent Application No. 60/864,153, filed November 02, 2006, now abandoned (HHS Ref. No. E– 227–2006/1–US–01); 3. U.S. Provisional Patent Application No. 60/888,754, filed February 07, 2007, now abandoned (HHS Ref. No. E–227– 2006/2–US–01); 4. U.S. Provisional Patent Application No. 60/910,549, filed April 06, 2007, now abandoned (HHS Ref. No. E–227– 2006/3–US–01); 5. U.S. Provisional Patent Application No. 60/956,375, filed August 16, 2007, now abandoned (HHS Ref. No. E–227– 2006/4–US–01); VerDate Sep<11>2014 20:27 May 14, 2018 Jkt 244001 6. PCT Patent Application No. PCT/ 2007/080647, filed October 5, 2007, now abandoned (HHS Ref. No. E–227–2006/ 5–PCT–01); 7. U.S. Patent No. 8,236,313, filed April 3, 2009, Issued August 7, 2012 (HHS Ref. No. E–227–2006/5–US–02); 8. Canadian Patent Application No. 2,665,287, October 5, 2007 (HHS Ref. No. E–227–2006/5–CA–03); 9. Australian Patent No. 2007319576, filed October 5, 2007, Issued May 1, 2014 (HHS Ref. No. E–227–2006/5–AU– 04); 10. European Patent Application No. 07868382.8, filed March 27, 2009 (HHS Ref. No. E–227–2006/5–EP–05); 11. U.S. Patent Application No. 13/ 546,931, filed July 11, 2012 (HHS Ref. No. E–227–2006/5–US–06); 12. U.S. Patent Number 8,557,788, filed July 11, 2012, Issued October 15, 2013 (HHS Ref. No. E–227–2006/5–US– 07); 13. European Patent Application No. 13180563.2, filed October 5, 2007 (HHS Ref. No. E–227–2006/5–EP–08); 14. Australian Patent No. 2014201936, filed October 5, 2007, Issued October 20, 2016 (HHS Ref. No. E–227–2006/5–AU– 09); 15. U.S. Patent Application No. 14/ 500,861, filed September 29, 2014 (HHS Ref. No. E–227–2006/5–US–10); 16. Australian Patent No. 2016238894, filed October 6, 2016, Issued February 22, 2018 (HHS Ref. No. E–227–2006/5– AU–11); 17. Australian Patent Application No. 2018200921, filed February 8, 2018 (HHS Ref. No. E–227–2006/5–AU–12). The patent rights in these inventions have been assigned and/or exclusively licensed to the government of the United States of America. The prospective exclusive license territory may be worldwide and the field of use may be limited to ‘‘the use of the CD47 phosphorodiamidate morpholino oligomers (PMO, morpholino, Sequence: 5′CGTCACAGGCAGGACCCACTGCCCA3′) for the treatment, prevention, and diagnosis of hematological cancers (e.g. lymphoma, leukemia, multiple myeloma), excluding uses in combination with radiotherapy.’’ This technology concerns CD47, originally named integrin-associated protein, which is a receptor for thrombospondin-1(TSP–1), a major component of platelet a-granules from which it is secreted on platelet activation. A number of important roles for CD47 have been defined in regulating the migration, proliferation, and survival of vascular cells, and in regulation of innate and adaptive immunity. Nitric Oxide (NO) plays an PO 00000 Frm 00061 Fmt 4703 Sfmt 4703 22501 important role as a major intrinsic vasodilator, and increases blood flow to tissues and organs. Disruption of this process leads to peripheral vascular disease, ischemic heart disease, stroke, diabetes and many more significant diseases. The inventors have discovered that TSP1 blocks the beneficial effects of NO, and prevents it from dilating blood vessels and increasing blood flow to organs and tissues. Additionally, they discovered that this regulation requires TSP1 interaction with its cell receptor, CD47. These inventors have also found that blocking TSP1–CD47 interaction through the use of antisense morpholino oligonucleotides, peptides, or antibodies has several therapeutic benefits including the treatment of cancer. This notice is made in accordance with 35 U.S.C. 209 and 37 CFR part 404. The prospective exclusive license will be royalty bearing, and the prospective exclusive license may be granted unless within fifteen (15) days from the date of this published notice, the National Cancer Institute receives written evidence and argument that establishes that the grant of the license would not be consistent with the requirements of 35 U.S.C. 209 and 37 CFR part 404. In response to this Notice, the public may file comments or objections. Comments and objections, other than those in the form of a license application, will not be treated confidentially, and may be made publicly available. License applications submitted in response to this Notice will be presumed to contain business confidential information and any release of information in these license applications will be made only as required and upon a request under the Freedom of Information Act, 5 U.S.C. 552. Dated: April 30, 2018. Richard U. Rodriguez, Associate Director, Technology Transfer Center, National Cancer Institute. [FR Doc. 2018–10238 Filed 5–14–18; 8:45 am] BILLING CODE 4140–01–P DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of General Medical Sciences; Notice of Closed Meeting Pursuant to section 10(d) of the Federal Advisory Committee Act, as amended, notice is hereby given of the following meeting. The meeting will be closed to the public in accordance with the E:\FR\FM\15MYN1.SGM 15MYN1 22502 Federal Register / Vol. 83, No. 94 / Tuesday, May 15, 2018 / Notices provisions set forth in sections 552b(c)(4) and 552b(c)(6), Title 5 U.S.C., as amended. The grant applications and the discussions could disclose confidential trade secrets or commercial property such as patentable material, and personal information concerning individuals associated with the grant applications, the disclosure of which would constitute a clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of General Medical Sciences Special Emphasis Panel; Review of Support of Competitive Research (SCORE) Award Applications. Date: July 12, 2018. Time: 8:00 a.m. to 5:00 p.m. Agenda: To review and evaluate grant applications. Place: Hilton Garden Inn Bethesda, 7301 Waverly Street, Bethesda, MD 20814. Contact Person: Saraswathy Seetharam, Scientific Review Officer, Office Scientific Review, National Institute of General Medical Sciences, National Institutes Health, 45 Center Drive, Room 3AN12C, Bethesda, MD 20892, 301–594–2763, seetharams@ nigms.nih.gov. (Catalogue of Federal Domestic Assistance Program Nos. 93.375, Minority Biomedical Research Support; 93.821, Cell Biology and Biophysics Research; 93.859, Pharmacology, Physiology, and Biological Chemistry Research; 93.862, Genetics and Developmental Biology Research; 93.88, Minority Access to Research Careers; 93.96, Special Minority Initiatives; 93.859, Biomedical Research and Research Training, National Institutes of Health, HHS) Dated: May 10, 2018. Melanie J. Pantoja, Program Analyst, Office of Federal Advisory Committee Policy. [FR Doc. 2018–10356 Filed 5–14–18; 8:45 am] BILLING CODE 4140–01–P DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health daltland on DSKBBV9HB2PROD with NOTICES National Institute on Aging; Notice of Closed Meeting Pursuant to section 10(d) of the Federal Advisory Committee Act, as amended, notice is hereby given of the following meeting. The meeting will be closed to the public in accordance with the provisions set forth in sections 552b(c)(4) and 552b(c)(6), Title 5 U.S.C., as amended. The contract proposals and the discussions could disclose confidential trade secrets or commercial property such as patentable material, and personal information concerning individuals associated with the contract proposals, the disclosure of which VerDate Sep<11>2014 20:27 May 14, 2018 Jkt 244001 would constitute a clearly unwarranted invasion of personal privacy. Name of Committee: National Institute on Aging Special Emphasis Panel; Training Grants. Date: June 8, 2018. Time: 3:00 p.m. to 5:30 p.m. Agenda: To review and evaluate contract proposals. Place: National Institute on Aging, Gateway Building, Suite 2W200, 7201 Wisconsin Avenue, Bethesda, MD 20892. Contact Person: Jeannette L. Johnson, Ph.D., National Institutes on Aging, National Institutes of Health, 7201 Wisconsin Avenue, Suite 2C212, Bethesda, MD 20892, 301–402– 7705, johnsonj9@nia.nih.gov. (Catalogue of Federal Domestic Assistance Program Nos. 93.866, Aging Research, National Institutes of Health, HHS) Dated: May 10, 2018. Melanie J. Pantoja, Program Analyst, Office of Federal Advisory Committee Policy. [FR Doc. 2018–10353 Filed 5–14–18; 8:45 am] BILLING CODE 4140–01–P DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Center for Advancing Translational Sciences; Notice of Closed Meeting Pursuant to section 10(d) of the Federal Advisory Committee Act, as amended, notice is hereby given of the following meeting. The meeting will be closed to the public in accordance with the provisions set forth in sections 552b(c)(4) and 552b(c)(6), Title 5 U.S.C., as amended. The grant applications and the discussions could disclose confidential trade secrets or commercial property such as patentable material, and personal information concerning individuals associated with the grant applications, the disclosure of which would constitute a clearly unwarranted invasion of personal privacy. Name of Committee: National Center for Advancing Translational Sciences Special Emphasis Panel; Tissue Chip Testing Center (TCTC) & Data Centers (DC). Date: June 13, 2018. Time: 8:00 a.m. to 5:00 p.m. Agenda: To review and evaluate grant applications. Place: National Institutes of Health, One Democracy Plaza, 6701 Democracy Boulevard, Bethesda, MD 20892 (Telephone Conference Call). Contact Person: Barbara J. Nelson, Ph.D., Scientific Review Officer, Office of Scientific Review, National Center for Advancing Translational Sciences (NCATS), National Institutes of Health 6701 Democracy Blvd., PO 00000 Frm 00062 Fmt 4703 Sfmt 4703 Democracy 1, Room 1080, Bethesda, MD 20892–4874, nelsonbj@mail.nih.gov. (Catalogue of Federal Domestic Assistance Program Nos. 93.859, Pharmacology, Physiology, and Biological Chemistry Research; 93.350, B—Cooperative Agreements; 93.859, Biomedical Research and Research Training, National Institutes of Health, HHS) Dated: May 9, 2018. David D. Clary, Program Analyst, Office of Federal Advisory Committee Policy. [FR Doc. 2018–10234 Filed 5–14–18; 8:45 am] BILLING CODE 4140–01–P DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of Dental and Craniofacial Research; Notice of Closed Meetings Pursuant to section 10(d) of the Federal Advisory Committee Act, as amended, notice is hereby given of the following meetings. The meetings will be closed to the public in accordance with the provisions set forth in sections 552b(c)(4) and 552b(c)(6), Title 5 U.S.C., as amended. The grant applications and the discussions could disclose confidential trade secrets or commercial property such as patentable material, and personal information concerning individuals associated with the grant applications, the disclosure of which would constitute a clearly unwarranted invasion of personal privacy. Name of Committee: National Institute of Dental and Craniofacial Research Special Emphasis Panel; NIDCR DSR Member Conflict SEP. Date: June 5, 2018. Time: 12:30 p.m. to 4:00 p.m. Agenda: To review and evaluate grant applications. Place: National Institutes of Health, One Democracy Plaza, 6701 Democracy Boulevard, Bethesda, MD 20892 (Telephone Conference Call). Contact Person: Marilyn Moore-Hoon, Ph.D., Scientific Review Officer, Scientific Review Branch, National Institute of Dental and Craniofacial Research, 6701 Democracy Blvd., Rm. 676, Bethesda, MD 20892–4878, 301–594–4861, mooremar@nidcr.nih.gov. Name of Committee: National Institute of Dental and Craniofacial Research Special Emphasis Panel; NIDCR Clinical Research Grant Reviews. Date: June 6, 2018. Time: 12:00 p.m. to 3:00 p.m. Agenda: To review and evaluate grant applications. Place: National Institutes of Health, One Democracy Plaza, 6701 Democracy Boulevard, Bethesda, MD 20892. E:\FR\FM\15MYN1.SGM 15MYN1

Agencies

[Federal Register Volume 83, Number 94 (Tuesday, May 15, 2018)]
[Notices]
[Pages 22501-22502]
From the Federal Register Online via the Government Publishing Office [www.gpo.gov]
[FR Doc No: 2018-10356]


-----------------------------------------------------------------------

DEPARTMENT OF HEALTH AND HUMAN SERVICES

National Institutes of Health


National Institute of General Medical Sciences; Notice of Closed 
Meeting

    Pursuant to section 10(d) of the Federal Advisory Committee Act, as 
amended, notice is hereby given of the following meeting.
    The meeting will be closed to the public in accordance with the

[[Page 22502]]

provisions set forth in sections 552b(c)(4) and 552b(c)(6), Title 5 
U.S.C., as amended. The grant applications and the discussions could 
disclose confidential trade secrets or commercial property such as 
patentable material, and personal information concerning individuals 
associated with the grant applications, the disclosure of which would 
constitute a clearly unwarranted invasion of personal privacy.

    Name of Committee: National Institute of General Medical 
Sciences Special Emphasis Panel; Review of Support of Competitive 
Research (SCORE) Award Applications.
    Date: July 12, 2018.
    Time: 8:00 a.m. to 5:00 p.m.
    Agenda: To review and evaluate grant applications.
    Place: Hilton Garden Inn Bethesda, 7301 Waverly Street, 
Bethesda, MD 20814.
    Contact Person: Saraswathy Seetharam, Scientific Review Officer, 
Office Scientific Review, National Institute of General Medical 
Sciences, National Institutes Health, 45 Center Drive, Room 3AN12C, 
Bethesda, MD 20892, 301-594-2763, [email protected].

(Catalogue of Federal Domestic Assistance Program Nos. 93.375, 
Minority Biomedical Research Support; 93.821, Cell Biology and 
Biophysics Research; 93.859, Pharmacology, Physiology, and 
Biological Chemistry Research; 93.862, Genetics and Developmental 
Biology Research; 93.88, Minority Access to Research Careers; 93.96, 
Special Minority Initiatives; 93.859, Biomedical Research and 
Research Training, National Institutes of Health, HHS)

    Dated: May 10, 2018.
Melanie J. Pantoja,
Program Analyst, Office of Federal Advisory Committee Policy.
[FR Doc. 2018-10356 Filed 5-14-18; 8:45 am]
BILLING CODE 4140-01-P