Prospective Grant of an Exclusive Patent License: Use of the CD47 Phosphorodiamidate Morpholino Oligomers for the Treatment, Prevention, and Diagnosis of Hematological Cancers, 22501 [2018-10238]

Download as PDF Federal Register / Vol. 83, No. 94 / Tuesday, May 15, 2018 / Notices DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health Prospective Grant of an Exclusive Patent License: Use of the CD47 Phosphorodiamidate Morpholino Oligomers for the Treatment, Prevention, and Diagnosis of Hematological Cancers AGENCY: National Institutes of Health, HHS. ACTION: Notice. The National Cancer Institute, an institute of the National Institutes of Health, Department of Health and Human Services, is contemplating the grant of an Exclusive Patent License to practice the inventions embodied in the Patents and Patent Applications listed in the Supplementary Information section of this notice to Morphiex Biotherapeutics (‘‘Morphiex’’) located in Boston, MA. DATES: Only written comments and/or applications for a license which are received by the National Cancer Institute’s Technology Transfer Center on or before May 30, 2018 will be considered. ADDRESSES: Requests for copies of the patent application, inquiries, and comments relating to the contemplated an Exclusive Patent License should be directed to: Jaime M. Greene, Senior Licensing and Patenting Manager, NCI Technology Transfer Center, 9609 Medical Center Drive, RM 1E530 MSC 9702, Bethesda, MD 20892–9702 (for business mail), Rockville, MD 20850– 9702 Telephone: (240) 276–5530; Facsimile: (240)–276–5504 Email: greenejaime@mail.nih.gov. SUPPLEMENTARY INFORMATION: daltland on DSKBBV9HB2PROD with NOTICES SUMMARY: Intellectual Property 1. U.S. Provisional Patent Application No. 60/850,132, filed October 6, 2006, now abandoned (HHS Ref. No. E–227– 2006/0–US–01); 2. U.S. Provisional Patent Application No. 60/864,153, filed November 02, 2006, now abandoned (HHS Ref. No. E– 227–2006/1–US–01); 3. U.S. Provisional Patent Application No. 60/888,754, filed February 07, 2007, now abandoned (HHS Ref. No. E–227– 2006/2–US–01); 4. U.S. Provisional Patent Application No. 60/910,549, filed April 06, 2007, now abandoned (HHS Ref. No. E–227– 2006/3–US–01); 5. U.S. Provisional Patent Application No. 60/956,375, filed August 16, 2007, now abandoned (HHS Ref. No. E–227– 2006/4–US–01); VerDate Sep<11>2014 20:27 May 14, 2018 Jkt 244001 6. PCT Patent Application No. PCT/ 2007/080647, filed October 5, 2007, now abandoned (HHS Ref. No. E–227–2006/ 5–PCT–01); 7. U.S. Patent No. 8,236,313, filed April 3, 2009, Issued August 7, 2012 (HHS Ref. No. E–227–2006/5–US–02); 8. Canadian Patent Application No. 2,665,287, October 5, 2007 (HHS Ref. No. E–227–2006/5–CA–03); 9. Australian Patent No. 2007319576, filed October 5, 2007, Issued May 1, 2014 (HHS Ref. No. E–227–2006/5–AU– 04); 10. European Patent Application No. 07868382.8, filed March 27, 2009 (HHS Ref. No. E–227–2006/5–EP–05); 11. U.S. Patent Application No. 13/ 546,931, filed July 11, 2012 (HHS Ref. No. E–227–2006/5–US–06); 12. U.S. Patent Number 8,557,788, filed July 11, 2012, Issued October 15, 2013 (HHS Ref. No. E–227–2006/5–US– 07); 13. European Patent Application No. 13180563.2, filed October 5, 2007 (HHS Ref. No. E–227–2006/5–EP–08); 14. Australian Patent No. 2014201936, filed October 5, 2007, Issued October 20, 2016 (HHS Ref. No. E–227–2006/5–AU– 09); 15. U.S. Patent Application No. 14/ 500,861, filed September 29, 2014 (HHS Ref. No. E–227–2006/5–US–10); 16. Australian Patent No. 2016238894, filed October 6, 2016, Issued February 22, 2018 (HHS Ref. No. E–227–2006/5– AU–11); 17. Australian Patent Application No. 2018200921, filed February 8, 2018 (HHS Ref. No. E–227–2006/5–AU–12). The patent rights in these inventions have been assigned and/or exclusively licensed to the government of the United States of America. The prospective exclusive license territory may be worldwide and the field of use may be limited to ‘‘the use of the CD47 phosphorodiamidate morpholino oligomers (PMO, morpholino, Sequence: 5′CGTCACAGGCAGGACCCACTGCCCA3′) for the treatment, prevention, and diagnosis of hematological cancers (e.g. lymphoma, leukemia, multiple myeloma), excluding uses in combination with radiotherapy.’’ This technology concerns CD47, originally named integrin-associated protein, which is a receptor for thrombospondin-1(TSP–1), a major component of platelet a-granules from which it is secreted on platelet activation. A number of important roles for CD47 have been defined in regulating the migration, proliferation, and survival of vascular cells, and in regulation of innate and adaptive immunity. Nitric Oxide (NO) plays an PO 00000 Frm 00061 Fmt 4703 Sfmt 4703 22501 important role as a major intrinsic vasodilator, and increases blood flow to tissues and organs. Disruption of this process leads to peripheral vascular disease, ischemic heart disease, stroke, diabetes and many more significant diseases. The inventors have discovered that TSP1 blocks the beneficial effects of NO, and prevents it from dilating blood vessels and increasing blood flow to organs and tissues. Additionally, they discovered that this regulation requires TSP1 interaction with its cell receptor, CD47. These inventors have also found that blocking TSP1–CD47 interaction through the use of antisense morpholino oligonucleotides, peptides, or antibodies has several therapeutic benefits including the treatment of cancer. This notice is made in accordance with 35 U.S.C. 209 and 37 CFR part 404. The prospective exclusive license will be royalty bearing, and the prospective exclusive license may be granted unless within fifteen (15) days from the date of this published notice, the National Cancer Institute receives written evidence and argument that establishes that the grant of the license would not be consistent with the requirements of 35 U.S.C. 209 and 37 CFR part 404. In response to this Notice, the public may file comments or objections. Comments and objections, other than those in the form of a license application, will not be treated confidentially, and may be made publicly available. License applications submitted in response to this Notice will be presumed to contain business confidential information and any release of information in these license applications will be made only as required and upon a request under the Freedom of Information Act, 5 U.S.C. 552. Dated: April 30, 2018. Richard U. Rodriguez, Associate Director, Technology Transfer Center, National Cancer Institute. [FR Doc. 2018–10238 Filed 5–14–18; 8:45 am] BILLING CODE 4140–01–P DEPARTMENT OF HEALTH AND HUMAN SERVICES National Institutes of Health National Institute of General Medical Sciences; Notice of Closed Meeting Pursuant to section 10(d) of the Federal Advisory Committee Act, as amended, notice is hereby given of the following meeting. The meeting will be closed to the public in accordance with the E:\FR\FM\15MYN1.SGM 15MYN1

Agencies

[Federal Register Volume 83, Number 94 (Tuesday, May 15, 2018)]
[Notices]
[Page 22501]
From the Federal Register Online via the Government Publishing Office [www.gpo.gov]
[FR Doc No: 2018-10238]



[[Page 22501]]

-----------------------------------------------------------------------

DEPARTMENT OF HEALTH AND HUMAN SERVICES

National Institutes of Health


Prospective Grant of an Exclusive Patent License: Use of the CD47 
Phosphorodiamidate Morpholino Oligomers for the Treatment, Prevention, 
and Diagnosis of Hematological Cancers

AGENCY: National Institutes of Health, HHS.

ACTION: Notice.

-----------------------------------------------------------------------

SUMMARY: The National Cancer Institute, an institute of the National 
Institutes of Health, Department of Health and Human Services, is 
contemplating the grant of an Exclusive Patent License to practice the 
inventions embodied in the Patents and Patent Applications listed in 
the Supplementary Information section of this notice to Morphiex 
Biotherapeutics (``Morphiex'') located in Boston, MA.

DATES: Only written comments and/or applications for a license which 
are received by the National Cancer Institute's Technology Transfer 
Center on or before May 30, 2018 will be considered.

ADDRESSES: Requests for copies of the patent application, inquiries, 
and comments relating to the contemplated an Exclusive Patent License 
should be directed to: Jaime M. Greene, Senior Licensing and Patenting 
Manager, NCI Technology Transfer Center, 9609 Medical Center Drive, RM 
1E530 MSC 9702, Bethesda, MD 20892-9702 (for business mail), Rockville, 
MD 20850-9702 Telephone: (240) 276-5530; Facsimile: (240)-276-5504 
Email: [email protected].

SUPPLEMENTARY INFORMATION: 

Intellectual Property

    1. U.S. Provisional Patent Application No. 60/850,132, filed 
October 6, 2006, now abandoned (HHS Ref. No. E-227-2006/0-US-01);
    2. U.S. Provisional Patent Application No. 60/864,153, filed 
November 02, 2006, now abandoned (HHS Ref. No. E-227-2006/1-US-01);
    3. U.S. Provisional Patent Application No. 60/888,754, filed 
February 07, 2007, now abandoned (HHS Ref. No. E-227-2006/2-US-01);
    4. U.S. Provisional Patent Application No. 60/910,549, filed April 
06, 2007, now abandoned (HHS Ref. No. E-227-2006/3-US-01);
    5. U.S. Provisional Patent Application No. 60/956,375, filed August 
16, 2007, now abandoned (HHS Ref. No. E-227-2006/4-US-01);
    6. PCT Patent Application No. PCT/2007/080647, filed October 5, 
2007, now abandoned (HHS Ref. No. E-227-2006/5-PCT-01);
    7. U.S. Patent No. 8,236,313, filed April 3, 2009, Issued August 7, 
2012 (HHS Ref. No. E-227-2006/5-US-02);
    8. Canadian Patent Application No. 2,665,287, October 5, 2007 (HHS 
Ref. No. E-227-2006/5-CA-03);
    9. Australian Patent No. 2007319576, filed October 5, 2007, Issued 
May 1, 2014 (HHS Ref. No. E-227-2006/5-AU-04);
    10. European Patent Application No. 07868382.8, filed March 27, 
2009 (HHS Ref. No. E-227-2006/5-EP-05);
    11. U.S. Patent Application No. 13/546,931, filed July 11, 2012 
(HHS Ref. No. E-227-2006/5-US-06);
    12. U.S. Patent Number 8,557,788, filed July 11, 2012, Issued 
October 15, 2013 (HHS Ref. No. E-227-2006/5-US-07);
    13. European Patent Application No. 13180563.2, filed October 5, 
2007 (HHS Ref. No. E-227-2006/5-EP-08);
    14. Australian Patent No. 2014201936, filed October 5, 2007, Issued 
October 20, 2016 (HHS Ref. No. E-227-2006/5-AU-09);
    15. U.S. Patent Application No. 14/500,861, filed September 29, 
2014 (HHS Ref. No. E-227-2006/5-US-10);
    16. Australian Patent No. 2016238894, filed October 6, 2016, Issued 
February 22, 2018 (HHS Ref. No. E-227-2006/5-AU-11);
    17. Australian Patent Application No. 2018200921, filed February 8, 
2018 (HHS Ref. No. E-227-2006/5-AU-12).
    The patent rights in these inventions have been assigned and/or 
exclusively licensed to the government of the United States of America.
    The prospective exclusive license territory may be worldwide and 
the field of use may be limited to ``the use of the CD47 
phosphorodiamidate morpholino oligomers (PMO, morpholino, Sequence: 5'-
CGTCACAGGCAGGACCCACTGCCCA-3') for the treatment, prevention, and 
diagnosis of hematological cancers (e.g. lymphoma, leukemia, multiple 
myeloma), excluding uses in combination with radiotherapy.''
    This technology concerns CD47, originally named integrin-associated 
protein, which is a receptor for thrombospondin-1(TSP-1), a major 
component of platelet [alpha]-granules from which it is secreted on 
platelet activation. A number of important roles for CD47 have been 
defined in regulating the migration, proliferation, and survival of 
vascular cells, and in regulation of innate and adaptive immunity. 
Nitric Oxide (NO) plays an important role as a major intrinsic 
vasodilator, and increases blood flow to tissues and organs. Disruption 
of this process leads to peripheral vascular disease, ischemic heart 
disease, stroke, diabetes and many more significant diseases. The 
inventors have discovered that TSP1 blocks the beneficial effects of 
NO, and prevents it from dilating blood vessels and increasing blood 
flow to organs and tissues. Additionally, they discovered that this 
regulation requires TSP1 interaction with its cell receptor, CD47. 
These inventors have also found that blocking TSP1-CD47 interaction 
through the use of antisense morpholino oligonucleotides, peptides, or 
antibodies has several therapeutic benefits including the treatment of 
cancer.
    This notice is made in accordance with 35 U.S.C. 209 and 37 CFR 
part 404. The prospective exclusive license will be royalty bearing, 
and the prospective exclusive license may be granted unless within 
fifteen (15) days from the date of this published notice, the National 
Cancer Institute receives written evidence and argument that 
establishes that the grant of the license would not be consistent with 
the requirements of 35 U.S.C. 209 and 37 CFR part 404.
    In response to this Notice, the public may file comments or 
objections. Comments and objections, other than those in the form of a 
license application, will not be treated confidentially, and may be 
made publicly available.
    License applications submitted in response to this Notice will be 
presumed to contain business confidential information and any release 
of information in these license applications will be made only as 
required and upon a request under the Freedom of Information Act, 5 
U.S.C. 552.

    Dated: April 30, 2018.
Richard U. Rodriguez,
Associate Director, Technology Transfer Center, National Cancer 
Institute.
[FR Doc. 2018-10238 Filed 5-14-18; 8:45 am]
 BILLING CODE 4140-01-P