Prospective Grant of an Exclusive Patent License: Use of the CD47 Phosphorodiamidate Morpholino Oligomers for the Treatment, Prevention, and Diagnosis of Hematological Cancers, 22501 [2018-10238]
Download as PDF
<![CDATA[
Federal Register / Vol. 83, No. 94 / Tuesday, May 15, 2018 / Notices
DEPARTMENT OF HEALTH AND
HUMAN SERVICES
National Institutes of Health
Prospective Grant of an Exclusive
Patent License: Use of the CD47
Phosphorodiamidate Morpholino
Oligomers for the Treatment,
Prevention, and Diagnosis of
Hematological Cancers
AGENCY:
National Institutes of Health,
HHS.
ACTION:
Notice.
The National Cancer Institute,
an institute of the National Institutes of
Health, Department of Health and
Human Services, is contemplating the
grant of an Exclusive Patent License to
practice the inventions embodied in the
Patents and Patent Applications listed
in the Supplementary Information
section of this notice to Morphiex
Biotherapeutics (‘‘Morphiex’’) located in
Boston, MA.
DATES: Only written comments and/or
applications for a license which are
received by the National Cancer
Institute’s Technology Transfer Center
on or before May 30, 2018 will be
considered.
ADDRESSES: Requests for copies of the
patent application, inquiries, and
comments relating to the contemplated
an Exclusive Patent License should be
directed to: Jaime M. Greene, Senior
Licensing and Patenting Manager, NCI
Technology Transfer Center, 9609
Medical Center Drive, RM 1E530 MSC
9702, Bethesda, MD 20892–9702 (for
business mail), Rockville, MD 20850–
9702 Telephone: (240) 276–5530;
Facsimile: (240)–276–5504 Email:
greenejaime@mail.nih.gov.
SUPPLEMENTARY INFORMATION:
daltland on DSKBBV9HB2PROD with NOTICES
SUMMARY:
Intellectual Property
1. U.S. Provisional Patent Application
No. 60/850,132, filed October 6, 2006,
now abandoned (HHS Ref. No. E–227–
2006/0–US–01);
2. U.S. Provisional Patent Application
No. 60/864,153, filed November 02,
2006, now abandoned (HHS Ref. No. E–
227–2006/1–US–01);
3. U.S. Provisional Patent Application
No. 60/888,754, filed February 07, 2007,
now abandoned (HHS Ref. No. E–227–
2006/2–US–01);
4. U.S. Provisional Patent Application
No. 60/910,549, filed April 06, 2007,
now abandoned (HHS Ref. No. E–227–
2006/3–US–01);
5. U.S. Provisional Patent Application
No. 60/956,375, filed August 16, 2007,
now abandoned (HHS Ref. No. E–227–
2006/4–US–01);
VerDate Sep<11>2014
20:27 May 14, 2018
Jkt 244001
6. PCT Patent Application No. PCT/
2007/080647, filed October 5, 2007, now
abandoned (HHS Ref. No. E–227–2006/
5–PCT–01);
7. U.S. Patent No. 8,236,313, filed
April 3, 2009, Issued August 7, 2012
(HHS Ref. No. E–227–2006/5–US–02);
8. Canadian Patent Application No.
2,665,287, October 5, 2007 (HHS Ref.
No. E–227–2006/5–CA–03);
9. Australian Patent No. 2007319576,
filed October 5, 2007, Issued May 1,
2014 (HHS Ref. No. E–227–2006/5–AU–
04);
10. European Patent Application No.
07868382.8, filed March 27, 2009 (HHS
Ref. No. E–227–2006/5–EP–05);
11. U.S. Patent Application No. 13/
546,931, filed July 11, 2012 (HHS Ref.
No. E–227–2006/5–US–06);
12. U.S. Patent Number 8,557,788,
filed July 11, 2012, Issued October 15,
2013 (HHS Ref. No. E–227–2006/5–US–
07);
13. European Patent Application No.
13180563.2, filed October 5, 2007 (HHS
Ref. No. E–227–2006/5–EP–08);
14. Australian Patent No. 2014201936,
filed October 5, 2007, Issued October 20,
2016 (HHS Ref. No. E–227–2006/5–AU–
09);
15. U.S. Patent Application No. 14/
500,861, filed September 29, 2014 (HHS
Ref. No. E–227–2006/5–US–10);
16. Australian Patent No. 2016238894,
filed October 6, 2016, Issued February
22, 2018 (HHS Ref. No. E–227–2006/5–
AU–11);
17. Australian Patent Application No.
2018200921, filed February 8, 2018
(HHS Ref. No. E–227–2006/5–AU–12).
The patent rights in these inventions
have been assigned and/or exclusively
licensed to the government of the
United States of America.
The prospective exclusive license
territory may be worldwide and the
field of use may be limited to ‘‘the use
of the CD47 phosphorodiamidate
morpholino oligomers (PMO,
morpholino, Sequence: 5′CGTCACAGGCAGGACCCACTGCCCA3′) for the treatment, prevention, and
diagnosis of hematological cancers (e.g.
lymphoma, leukemia, multiple
myeloma), excluding uses in
combination with radiotherapy.’’
This technology concerns CD47,
originally named integrin-associated
protein, which is a receptor for
thrombospondin-1(TSP–1), a major
component of platelet a-granules from
which it is secreted on platelet
activation. A number of important roles
for CD47 have been defined in
regulating the migration, proliferation,
and survival of vascular cells, and in
regulation of innate and adaptive
immunity. Nitric Oxide (NO) plays an
PO 00000
Frm 00061
Fmt 4703
Sfmt 4703
22501
important role as a major intrinsic
vasodilator, and increases blood flow to
tissues and organs. Disruption of this
process leads to peripheral vascular
disease, ischemic heart disease, stroke,
diabetes and many more significant
diseases. The inventors have discovered
that TSP1 blocks the beneficial effects of
NO, and prevents it from dilating blood
vessels and increasing blood flow to
organs and tissues. Additionally, they
discovered that this regulation requires
TSP1 interaction with its cell receptor,
CD47. These inventors have also found
that blocking TSP1–CD47 interaction
through the use of antisense morpholino
oligonucleotides, peptides, or antibodies
has several therapeutic benefits
including the treatment of cancer.
This notice is made in accordance
with 35 U.S.C. 209 and 37 CFR part 404.
The prospective exclusive license will
be royalty bearing, and the prospective
exclusive license may be granted unless
within fifteen (15) days from the date of
this published notice, the National
Cancer Institute receives written
evidence and argument that establishes
that the grant of the license would not
be consistent with the requirements of
35 U.S.C. 209 and 37 CFR part 404.
In response to this Notice, the public
may file comments or objections.
Comments and objections, other than
those in the form of a license
application, will not be treated
confidentially, and may be made
publicly available.
License applications submitted in
response to this Notice will be
presumed to contain business
confidential information and any release
of information in these license
applications will be made only as
required and upon a request under the
Freedom of Information Act, 5 U.S.C.
552.
Dated: April 30, 2018.
Richard U. Rodriguez,
Associate Director, Technology Transfer
Center, National Cancer Institute.
[FR Doc. 2018–10238 Filed 5–14–18; 8:45 am]
BILLING CODE 4140–01–P
DEPARTMENT OF HEALTH AND
HUMAN SERVICES
National Institutes of Health
National Institute of General Medical
Sciences; Notice of Closed Meeting
Pursuant to section 10(d) of the
Federal Advisory Committee Act, as
amended, notice is hereby given of the
following meeting.
The meeting will be closed to the
public in accordance with the
E:\FR\FM\15MYN1.SGM
15MYN1
]]>Agencies
[Federal Register Volume 83, Number 94 (Tuesday, May 15, 2018)]
[Notices]
[Page 22501]
From the Federal Register Online via the Government Publishing Office [www.gpo.gov]
[FR Doc No: 2018-10238]
[[Page 22501]]
-----------------------------------------------------------------------
DEPARTMENT OF HEALTH AND HUMAN SERVICES
National Institutes of Health
Prospective Grant of an Exclusive Patent License: Use of the CD47
Phosphorodiamidate Morpholino Oligomers for the Treatment, Prevention,
and Diagnosis of Hematological Cancers
AGENCY: National Institutes of Health, HHS.
ACTION: Notice.
-----------------------------------------------------------------------
SUMMARY: The National Cancer Institute, an institute of the National
Institutes of Health, Department of Health and Human Services, is
contemplating the grant of an Exclusive Patent License to practice the
inventions embodied in the Patents and Patent Applications listed in
the Supplementary Information section of this notice to Morphiex
Biotherapeutics (``Morphiex'') located in Boston, MA.
DATES: Only written comments and/or applications for a license which
are received by the National Cancer Institute's Technology Transfer
Center on or before May 30, 2018 will be considered.
ADDRESSES: Requests for copies of the patent application, inquiries,
and comments relating to the contemplated an Exclusive Patent License
should be directed to: Jaime M. Greene, Senior Licensing and Patenting
Manager, NCI Technology Transfer Center, 9609 Medical Center Drive, RM
1E530 MSC 9702, Bethesda, MD 20892-9702 (for business mail), Rockville,
MD 20850-9702 Telephone: (240) 276-5530; Facsimile: (240)-276-5504
Email: [email protected].
SUPPLEMENTARY INFORMATION:
Intellectual Property
1. U.S. Provisional Patent Application No. 60/850,132, filed
October 6, 2006, now abandoned (HHS Ref. No. E-227-2006/0-US-01);
2. U.S. Provisional Patent Application No. 60/864,153, filed
November 02, 2006, now abandoned (HHS Ref. No. E-227-2006/1-US-01);
3. U.S. Provisional Patent Application No. 60/888,754, filed
February 07, 2007, now abandoned (HHS Ref. No. E-227-2006/2-US-01);
4. U.S. Provisional Patent Application No. 60/910,549, filed April
06, 2007, now abandoned (HHS Ref. No. E-227-2006/3-US-01);
5. U.S. Provisional Patent Application No. 60/956,375, filed August
16, 2007, now abandoned (HHS Ref. No. E-227-2006/4-US-01);
6. PCT Patent Application No. PCT/2007/080647, filed October 5,
2007, now abandoned (HHS Ref. No. E-227-2006/5-PCT-01);
7. U.S. Patent No. 8,236,313, filed April 3, 2009, Issued August 7,
2012 (HHS Ref. No. E-227-2006/5-US-02);
8. Canadian Patent Application No. 2,665,287, October 5, 2007 (HHS
Ref. No. E-227-2006/5-CA-03);
9. Australian Patent No. 2007319576, filed October 5, 2007, Issued
May 1, 2014 (HHS Ref. No. E-227-2006/5-AU-04);
10. European Patent Application No. 07868382.8, filed March 27,
2009 (HHS Ref. No. E-227-2006/5-EP-05);
11. U.S. Patent Application No. 13/546,931, filed July 11, 2012
(HHS Ref. No. E-227-2006/5-US-06);
12. U.S. Patent Number 8,557,788, filed July 11, 2012, Issued
October 15, 2013 (HHS Ref. No. E-227-2006/5-US-07);
13. European Patent Application No. 13180563.2, filed October 5,
2007 (HHS Ref. No. E-227-2006/5-EP-08);
14. Australian Patent No. 2014201936, filed October 5, 2007, Issued
October 20, 2016 (HHS Ref. No. E-227-2006/5-AU-09);
15. U.S. Patent Application No. 14/500,861, filed September 29,
2014 (HHS Ref. No. E-227-2006/5-US-10);
16. Australian Patent No. 2016238894, filed October 6, 2016, Issued
February 22, 2018 (HHS Ref. No. E-227-2006/5-AU-11);
17. Australian Patent Application No. 2018200921, filed February 8,
2018 (HHS Ref. No. E-227-2006/5-AU-12).
The patent rights in these inventions have been assigned and/or
exclusively licensed to the government of the United States of America.
The prospective exclusive license territory may be worldwide and
the field of use may be limited to ``the use of the CD47
phosphorodiamidate morpholino oligomers (PMO, morpholino, Sequence: 5'-
CGTCACAGGCAGGACCCACTGCCCA-3') for the treatment, prevention, and
diagnosis of hematological cancers (e.g. lymphoma, leukemia, multiple
myeloma), excluding uses in combination with radiotherapy.''
This technology concerns CD47, originally named integrin-associated
protein, which is a receptor for thrombospondin-1(TSP-1), a major
component of platelet [alpha]-granules from which it is secreted on
platelet activation. A number of important roles for CD47 have been
defined in regulating the migration, proliferation, and survival of
vascular cells, and in regulation of innate and adaptive immunity.
Nitric Oxide (NO) plays an important role as a major intrinsic
vasodilator, and increases blood flow to tissues and organs. Disruption
of this process leads to peripheral vascular disease, ischemic heart
disease, stroke, diabetes and many more significant diseases. The
inventors have discovered that TSP1 blocks the beneficial effects of
NO, and prevents it from dilating blood vessels and increasing blood
flow to organs and tissues. Additionally, they discovered that this
regulation requires TSP1 interaction with its cell receptor, CD47.
These inventors have also found that blocking TSP1-CD47 interaction
through the use of antisense morpholino oligonucleotides, peptides, or
antibodies has several therapeutic benefits including the treatment of
cancer.
This notice is made in accordance with 35 U.S.C. 209 and 37 CFR
part 404. The prospective exclusive license will be royalty bearing,
and the prospective exclusive license may be granted unless within
fifteen (15) days from the date of this published notice, the National
Cancer Institute receives written evidence and argument that
establishes that the grant of the license would not be consistent with
the requirements of 35 U.S.C. 209 and 37 CFR part 404.
In response to this Notice, the public may file comments or
objections. Comments and objections, other than those in the form of a
license application, will not be treated confidentially, and may be
made publicly available.
License applications submitted in response to this Notice will be
presumed to contain business confidential information and any release
of information in these license applications will be made only as
required and upon a request under the Freedom of Information Act, 5
U.S.C. 552.
Dated: April 30, 2018.
Richard U. Rodriguez,
Associate Director, Technology Transfer Center, National Cancer
Institute.
[FR Doc. 2018-10238 Filed 5-14-18; 8:45 am]
BILLING CODE 4140-01-P
